Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4279 bp · TkA06G064110|TK1151|cDNA
AACTGGTTAGGTGTGCGCGTAGATAGACATATATCCTATTAGCTCGAACGGGGAGTGTGATACAATTCTGAGATTTCTCTCCTTTTTGCTCTTTCCCCTTTCTCCTCGAACGACACCCACCTTCTTTTCTCACTTTTTCTTATCCTCAACGTCAATCTATACGTTCAGGGATCCAGGTTTTCAGGATAGACTTTTGGGGTTTTCGATGGAAAATGGCGTGACTAAGGTGGAAGAAGTAAAGTTAAAAGTAGAGGAATATG...
2700 bp · TkA06G064110|TK1151|CDS
ATGATGAGAGTACTTAATCACAAAGAGAAACTCGAAAGTTCAACAAATAATGTCCCAAATATGCAAACCGATCTAAAACTTCAAGAACCTCAAGAGGAACAACAGGAAACTTCTATTCCATCTTCATTACATCAGGATGATAAAAACCAGCAACAAGAAAGTACTTCCGCCATCAATGAGCCGGATAACAAACCAAAGAGCCCTAAAATTGAAAAAATCAATCTTAAAGATTATGATGTAAAACATAGTATGCCATTGAA...
Protein
Download Protein FASTA899 aa · TkA06G064110|TK1151|PROTEIN
MMRVLNHKEKLESSTNNVPNMQTDLKLQEPQEEQQETSIPSSLHQDDKNQQQESTSAINEPDNKPKSPKIEKINLKDYDVKHSMPLKKEPEVSRPIIGVSLPTEKPSTTPTPIPNPKPDPKPNQPTIPNSTPPGTQTRPAGLGNGAPLLEPSHRVAQSQPNGTSTSTGTSTTPPPQNQVIDEPTTEPEENDDTREKLQMIRVKFLRLARRLGQTPHNVVVAQVLYRLGLAEQLRGRNGGRVAAFSFERASAMAEQLESTG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G064110 |
|---|---|
| TK1151 ID | TkA06G064110 |
| OH-1004 ID | LXL04_037059 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 46.900 |
| Protein coverage (%) | TK1151 77.642 / OH-1004 51.322Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G064110 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:17276668-17281349 (+) | |||||||||
| Description | Similar to TOC159: Translocase of chloroplast 159, chloroplastic | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0045036 protein targeting to chloroplast Biological Process GO:0045037 protein import into chloroplast stroma Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0009536 plastid Cellular Component GO:0009707 chloroplast outer membrane Cellular Component GO:0009941 chloroplast envelope Cellular Component GO:0061927 TOC-TIC supercomplex I Cellular Component GO:0003924 GTPase activity Molecular Function GO:0004888 transmembrane signaling receptor activity Molecular Function GO:0004930 G protein-coupled receptor activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT2G16640 ath:AT3G16620 ath:AT4G02510 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01935DUF8722-67 aaPF13191AAA_16191-219 aaPF00735Septin266-347 aaPF04548AIG1268-416 aaPF03193RsgA_GTPase268-325 aaPF13191AAA_16268-376 aaPF02421FeoB_N269-355 aaPF05729NACHT269-291 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G064110 | PF01935 | DUF87 | 22 | 67 | 0.55 | 11.0 |
| TkA06G064110 | PF13191 | AAA_16 | 191 | 219 | 0.018 | 16.3 |
| TkA06G064110 | PF00735 | Septin | 266 | 347 | 8.2e-05 | 22.7 |
| TkA06G064110 | PF04548 | AIG1 | 268 | 416 | 9.1e-26 | 91.2 |
| TkA06G064110 | PF03193 | RsgA_GTPase | 268 | 325 | 0.00021 | 21.9 |
| TkA06G064110 | PF13191 | AAA_16 | 268 | 376 | 0.018 | 16.3 |
| TkA06G064110 | PF02421 | FeoB_N | 269 | 355 | 0.045 | 14.0 |
| TkA06G064110 | PF05729 | NACHT | 269 | 291 | 0.05 | 14.1 |
| TkA06G064110 | PF01926 | MMR_HSR1 | 270 | 357 | 2e-10 | 41.5 |
| TkA06G064110 | PF04670 | Gtr1_RagA | 270 | 345 | 0.035 | 14.2 |
| TkA06G064110 | PF01935 | DUF87 | 272 | 291 | 0.55 | 11.0 |
| TkA06G064110 | PF05729 | NACHT | 338 | 407 | 0.05 | 14.1 |
| TkA06G064110 | PF04548 | AIG1 | 407 | 450 | 9.1e-26 | 91.2 |
| TkA06G064110 | PF01935 | DUF87 | 555 | 621 | 0.55 | 11.0 |
| TkA06G064110 | PF12870 | DUF4878 | 559 | 630 | 0.22 | 12.6 |
| TkA06G064110 | PF00735 | Septin | 583 | 591 | 8.2e-05 | 22.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.