TkA06G062380 | RubberDandelionOmics

Gene overview

TkA06G062380

Reference: TK1151 Chr: Chr06 Coordinates: 16840709-16847888 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2132 bp · TkA06G062380|TK1151|cDNA

TTTATTCGTTACGTAACATTTGTTTCTTCAAATATGTCAAGGAGGAATAAAATAAAGTAACGCTATGTGTGGCATGGATCCTCCCGATGCATAAAACAACACAAACCTAGCACTCCCACTTTGGCTATCTATAGCCCCACGCGTCCCCGTCTTTCCTCCCGATTACCTCTTTCAAAATATGGCCGCCGCCGCCTCCTTCTCCTCCGCCACCGCCACCCGCATCTCTCCAACCTCTAAACCCCTCAACAAATCTCCTTCCT...

CDS

Download CDS FASTA

1257 bp · TkA06G062380|TK1151|CDS

ATGCTGAAAAACGTCCAGCCCTTCGTCGCTGGCTACCGCTTTGGTCGAGTAGGTGTCGCCCACAACGGCAATGTGGTAAATTATCAAACCCTGAGACACGAACTCGAAGAAAACGGTTCAATTTTTGGAACCACTTCCGATACCGAAGTTGTCCTGCATCTAATCGCCATATCGAAACAAAGACCCTTCTTTCTAAGAATCGTCGAAGCTTGTGAAAAGCTCAAAGGAGCTTATTCAATGGTGTTCATAACCGAAGATAA...

Protein

Download Protein FASTA

418 aa · TkA06G062380|TK1151|PROTEIN

MLKNVQPFVAGYRFGRVGVAHNGNVVNYQTLRHELEENGSIFGTTSDTEVVLHLIAISKQRPFFLRIVEACEKLKGAYSMVFITEDKLVAVRDPHGFRPLVMGRRSNGAVVFASETCALDLIEATYEREVNPGEVLVVDKDGIQSQCLMPHPEPKSCIFEHIYFSLPNSIVFGMSVYESRRKFGEILATEAPVDCDVVIAVPDSGVVAALGYAAKAGVPFQQGLIRSHYVGRTFIEPSQRIRDFGVKLKLSPVRAVLEGK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G062380`
TK1151 ID	TkA06G062380
OH-1004 ID	LXL04_025382
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 71.088 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G062380

Location Chr06:16840709-16847888 (-)

Description Similar to ASE1: Amidophosphoribosyltransferase 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34740`	Catalyzes the first committed step of 'de novo purine biosynthesis from glutamine.	Molecular analysis of "de novo" purine biosynthesis in solanaceous species and in Arabidopsis thaliana.2004 · DOI: 10.2741/1344 Characterization of Arabidopsis glutamine phosphoribosyl pyrophosphate amidotransferase-deficient mutants.2004 · DOI: 10.1104/pp.104.040956 Chemical genetic identification of glutamine phosphoribosylpyrophosphate amidotransferase as the target for a novel bleaching herbicide in Arabidopsis.2007 · DOI: 10.1104/pp.107.099705
`At2g16570`	Catalyzes the first committed step of 'de novo' purine biosynthesis from glutamine.	Characterization of Arabidopsis glutamine phosphoribosyl pyrophosphate amidotransferase-deficient mutants.2004 · DOI: 10.1104/pp.104.040956
`At4g38880`	Catalyzes the first committed step of 'de novo' purine biosynthesis from glutamine.	Chemical genetic identification of glutamine phosphoribosylpyrophosphate amidotransferase as the target for a novel bleaching herbicide in Arabidopsis.2007 · DOI: 10.1104/pp.107.099705

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025382 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006164 purine nucleotide biosynthetic process Biological Process

GO:0006189 'de novo' IMP biosynthetic process Biological Process

GO:0009113 purine nucleobase biosynthetic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009532 plastid stroma Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004044 amidophosphoribosyltransferase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G16570

ath:AT4G34740

ath:AT4G38880

gmx:548065

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.680

Rank 1 · TkA06G062380 · TK1151

Nucleus0.251

Rank 2 · TkA06G062380 · TK1151

Plastid0.089

Rank 3 · TkA06G062380 · TK1151

Peroxisome0.088

Rank 4 · TkA06G062380 · TK1151

Mitochondrion0.070

Rank 5 · TkA06G062380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13537GATase_74-119 aa

PF13522GATase_65-121 aa

PF00310GATase_272-140 aa

PF00156Pribosyltran181-291 aa

PF11382MctB243-288 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G062380	`PF13537`	GATase_7	4	119	5.4e-23	82.1
TkA06G062380	`PF13522`	GATase_6	5	121	5.3e-18	65.9
TkA06G062380	`PF00310`	GATase_2	72	140	0.013	15.0
TkA06G062380	`PF00156`	Pribosyltran	181	291	4.7e-10	39.7
TkA06G062380	`PF11382`	MctB	243	288	0.21	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STG9`	Arabidopsis thaliana	sp\|Q9STG9\|ASE2_ARATH Amidophosphoribosyltransferase 2, chloroplastic	85.000%	Swiss-Prot	High
`Q9SI61`	Arabidopsis thaliana	sp\|Q9SI61\|ASE1_ARATH Amidophosphoribosyltransferase 1, chloroplastic	85.300%	Swiss-Prot	High
`Q9T0J5`	Arabidopsis thaliana	sp\|Q9T0J5\|ASE3_ARATH Amidophosphoribosyltransferase 3, chloroplastic	74.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card