TkA06G061840 | RubberDandelionOmics

Gene overview

TkA06G061840

Reference: TK1151 Chr: Chr06 Coordinates: 16695981-16697666 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1407 bp · TkA06G061840|TK1151|cDNA

ATGCCCTCTGCTGAGGAGATGGGTGCAAGTTCTGAGGTTGTAACATCATCGTCCCTCTTGGCGAAGCCGACTGCCATAAAGGCGTCCAAATCTGCTTTTCATCGGACGTTGGTTGGTGCCGGTCTTGGTTTTGGCAAATTTGCTAAGGCCGTCGTGTCTTCTCCTGAGTTGCTGGTAGCCTCAGAGAAACAAACTGAGGATGTTGGTGTTCATCATGACGTACCGCCGATGAGTGCTTCCGATGGTGCTGAGGCAGTCTT...

CDS

Download CDS FASTA

1407 bp · TkA06G061840|TK1151|CDS

ATGCCCTCTGCTGAGGAGATGGGTGCAAGTTCTGAGGTTGTAACATCATCGTCCCTCTTGGCGAAGCCGACTGCCATAAAGGCGTCCAAATCTGCTTTTCATCGGACGTTGGTTGGTGCCGGTCTTGGTTTTGGCAAATTTGCTAAGGCCGTCGTGTCTTCTCCTGAGTTGCTGGTAGCCTCAGAGAAACAAACTGAGGATGTTGGTGTTCATCATGACGTACCGCCGATGAGTGCTTCCGATGGTGCTGAGGCAGTCTT...

Protein

Download Protein FASTA

468 aa · TkA06G061840|TK1151|PROTEIN

MPSAEEMGASSEVVTSSSLLAKPTAIKASKSAFHRTLVGAGLGFGKFAKAVVSSPELLVASEKQTEDVGVHHDVPPMSASDGAEAVLNIPDVPASPESGDKVSGMSTPTIAKDSAHPSFMSLSTALPAFMHPYTPSGVARPPGLGNLSEEEGLDRARSLFLEGMHWATEVMLMQRTRAASLLARKAEFDRVSAKVDEVNTAHVRMMEERTKLLQDYQRMELRNQELTMEIDGMKERHREMVEMNQALQKQLEDVQQYREA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G061840`
TK1151 ID	TkA06G061840
OH-1004 ID	LXL04_025394
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.700
Protein coverage (%)	TK1151 94.872 / OH-1004 39.778 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G061840`
Location	Chr06:16695981-16697666 (+)
Description	Similar to HAT: Zinc finger BED domain-containing protein DAYSLEEPER
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025394` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0009791 post-embryonic development Biological Process GO:0032196 transposition Biological Process GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0003677 DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0046983 protein dimerization activity Molecular Function
KEGG gene cross-reference	ath:AT3G42170 dosa:Os01g0518400 dosa:Os03g0733400 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.886

Rank 1 · TkA06G061840 · TK1151

Cytoplasm0.209

Rank 2 · TkA06G061840 · TK1151

Mitochondrion0.031

Rank 3 · TkA06G061840 · TK1151

Cell membrane0.018

Rank 4 · TkA06G061840 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA06G061840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01814Hemerythrin163-264 aa

PF14661HAUS6_N180-264 aa

PF06810Phage_scaffold181-255 aa

PF29997SPC25_N185-256 aa

PF24423OVT1186-261 aa

PF28052PA2816201-259 aa

PF06785UPF0242206-289 aa

PF29997SPC25_N261-322 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G061840	`PF01814`	Hemerythrin	163	264	1.2	10.3
TkA06G061840	`PF14661`	HAUS6_N	180	264	0.95	9.7
TkA06G061840	`PF06810`	Phage_scaffold	181	255	6.5	7.4
TkA06G061840	`PF29997`	SPC25_N	185	256	1.4	9.9
TkA06G061840	`PF24423`	OVT1	186	261	2.2	9.5
TkA06G061840	`PF28052`	PA2816	201	259	0.014	15.9
TkA06G061840	`PF06785`	UPF0242	206	289	0.47	11.2
TkA06G061840	`PF29997`	SPC25_N	261	322	1.4	9.9
TkA06G061840	`PF24423`	OVT1	262	273	2.2	9.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card