TkA06G060350 | RubberDandelionOmics

Gene overview

TkA06G060350

Reference: TK1151 Chr: Chr06 Coordinates: 16289896-16290879 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

633 bp · TkA06G060350|TK1151|cDNA

ATGCCTCTCATACTATCATCTTCTTTCATAACCCCTTGTTCTTTTGTTGATAATGTCAAAGAACCCCATATTATATTCCCACATCCACATTGCAACATTCTTCAAAAATGCTTATTTCCTAATAAGCATACTTCCATAATTCTAAAACACAAACCAGCACCCTCGAAACTCATAGCAAGAGAATCCATGAACTCCAGCTATGAACTCTTGGAAGAGAATTGGATAGATGAAGAAGGTGTGGTGGATCTGCTGCTGATTGT...

CDS

Download CDS FASTA

633 bp · TkA06G060350|TK1151|CDS

ATGCCTCTCATACTATCATCTTCTTTCATAACCCCTTGTTCTTTTGTTGATAATGTCAAAGAACCCCATATTATATTCCCACATCCACATTGCAACATTCTTCAAAAATGCTTATTTCCTAATAAGCATACTTCCATAATTCTAAAACACAAACCAGCACCCTCGAAACTCATAGCAAGAGAATCCATGAACTCCAGCTATGAACTCTTGGAAGAGAATTGGATAGATGAAGAAGGTGTGGTGGATCTGCTGCTGATTGT...

Protein

Download Protein FASTA

210 aa · TkA06G060350|TK1151|PROTEIN

MPLILSSSFITPCSFVDNVKEPHIIFPHPHCNILQKCLFPNKHTSIILKHKPAPSKLIARESMNSSYELLEENWIDEEGVVDLLLIVCFPIFSMVLGEEPIEEPEIINMGVIYGQNKVNGNEDDIASVDLDDWLYFPPKEKVIYISKHVRDMVHLEIKISAICDPMCKGLCLKCGQNLNTSTCSCSQQRSKLWATWRTQRENATIGDSPF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G060350`
TK1151 ID	TkA06G060350
OH-1004 ID	LXL04_034699
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	78.800
Protein coverage (%)	TK1151 38.095 / OH-1004 28.947 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G060350

Location Chr06:16289896-16290879 (+)

Description Similar to At3g19810: Large ribosomal RNA subunit accumulation protein YCED homolog 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19810`	Plays a role in synthesis, processing and/or stability of 23S rRNA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034699 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042254 ribosome biogenesis Biological Process

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

KEGG gene cross-reference

ath:AT3G19810

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.452

Rank 1 · TkA06G060350 · TK1151

Cytoplasm0.399

Rank 2 · TkA06G060350 · TK1151

Mitochondrion0.119

Rank 3 · TkA06G060350 · TK1151

Endoplasmic reticulum0.076

Rank 4 · TkA06G060350 · TK1151

Cell membrane0.065

Rank 5 · TkA06G060350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02620YceD70-84 aa

PF02620YceD116-194 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G060350	`PF02620`	YceD	70	84	4.2e-11	43.7
TkA06G060350	`PF02620`	YceD	116	194	4.2e-11	43.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT27`	Arabidopsis thaliana	sp\|Q9LT27\|YCED1_ARATH Large ribosomal RNA subunit accumulation protein YCED homolog 1, chloroplastic	50.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card