TkA06G058070 | RubberDandelionOmics

Gene overview

TkA06G058070

Reference: TK1151 Chr: Chr06 Coordinates: 15659229-15660652 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1091 bp · TkA06G058070|TK1151|cDNA

GCTTTTTATGGTAAAGGCTACCAATAATAAACTCTGTTCTCTTGCAGCTCTTGTCTGGTGATTATCGAAGATCACTCCCTCTTCCCTCCATAATTCTTAGCCTGAATCCTAACCCACATTCTGATCTTAGGGTTTGGGATTTCGGTTTTACGTTGCTCATAACAATACGAGGTCGAATTCTCTTGTTAGGGGTGTTAGTGATAGATAGATTCATCCTAGAAAATGACGCCGGTGGCCAGGAGTTGCATGCAATTGTTGCT...

CDS

Download CDS FASTA

603 bp · TkA06G058070|TK1151|CDS

ATGACGCCGGTGGCCAGGAGTTGCATGCAATTGTTGCTGAAACTTGCTAATTCTGTCATGGGGATGTGTGGAATCGCGACGATTTGTTACGCCGTATGGATGATTAAGATTTGGCATCACCAAGTACACGACTCCTATCCCCTTGCTCCTTGGTTTATGTATGCGATCTTTGGATTCGGTGCAATTCTGTGTGCGATAACATGCTGGGGTCATATCGCTGCAGAAATCGCAAATACTTGCTGTCTCTATTGTTACCTTAT...

Protein

Download Protein FASTA

200 aa · TkA06G058070|TK1151|PROTEIN

MTPVARSCMQLLLKLANSVMGMCGIATICYAVWMIKIWHHQVHDSYPLAPWFMYAIFGFGAILCAITCWGHIAAEIANTCCLYCYLIFIFLILIMEGAVTMDIIMNPNWEKDFPHDPSGNLVEFRDFIKENTHFCRWVGLSILSLEGLSMFLAVVLIALGPHEKGYDSDNEYTLEGVPLLKNYSKHVNMRPLQSSIIWQL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G058070`
TK1151 ID	TkA06G058070
OH-1004 ID	LXL04_019896
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	57.600
Protein coverage (%)	TK1151 91.500 / OH-1004 96.842 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G058070

Location Chr06:15659229-15660652 (-)

Description Similar to TOM2AH3: Tetraspanin-19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g20740`	May be involved in the regulation of cell differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019896 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G32400

ath:AT2G20230

ath:AT2G20740

ath:AT4G28770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.407

Rank 1 · TkA06G058070 · TK1151

Cytoplasm0.309

Rank 2 · TkA06G058070 · TK1151

Cell membrane0.299

Rank 3 · TkA06G058070 · TK1151

Golgi apparatus0.136

Rank 4 · TkA06G058070 · TK1151

Endoplasmic reticulum0.101

Rank 5 · TkA06G058070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27338CbsB8-106 aa

PF00335Tetraspanin12-105 aa

PF24358ABCC10_N15-91 aa

PF06168DUF98119-99 aa

PF00335Tetraspanin122-157 aa

PF24358ABCC10_N140-154 aa

PF06168DUF981140-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G058070	`PF27338`	CbsB	8	106	0.095	12.7
TkA06G058070	`PF00335`	Tetraspanin	12	105	7e-10	39.7
TkA06G058070	`PF24358`	ABCC10_N	15	91	0.0041	17.3
TkA06G058070	`PF06168`	DUF981	19	99	0.028	15.0
TkA06G058070	`PF00335`	Tetraspanin	122	157	7e-10	39.7
TkA06G058070	`PF24358`	ABCC10_N	140	154	0.0041	17.3
TkA06G058070	`PF06168`	DUF981	140	159	0.028	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940P5`	Arabidopsis thaliana	sp\|Q940P5\|TET19_ARATH Tetraspanin-19	51.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card