TkA06G057790 | RubberDandelionOmics

Gene overview

TkA06G057790

Reference: TK1151 Chr: Chr06 Coordinates: 15595793-15597872 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

675 bp · TkA06G057790|TK1151|cDNA

ATGGGAATCATACCGAAGAAAAAAGACGAAAACTTGGATGAGATTATGAATTGGGTTGAATGGATTCTTTCGCATTCACTTTTGCGTATTGCCGAAAGTAACCCTTATGGTTTGGATCAGTTTTGGCTGACTCAAGGGGAAGATCTTTTGCTTAATTTGATGCAAAGTTTTCAAGAAGATGTTCAAGAAAGGTCTGCAACAGGGCTTGCTACTTTTGTGGTGATTGATGATGAAAATGCAAATGTTGATGTGGGGAGGGC...

CDS

Download CDS FASTA

675 bp · TkA06G057790|TK1151|CDS

ATGGGAATCATACCGAAGAAAAAAGACGAAAACTTGGATGAGATTATGAATTGGGTTGAATGGATTCTTTCGCATTCACTTTTGCGTATTGCCGAAAGTAACCCTTATGGTTTGGATCAGTTTTGGCTGACTCAAGGGGAAGATCTTTTGCTTAATTTGATGCAAAGTTTTCAAGAAGATGTTCAAGAAAGGTCTGCAACAGGGCTTGCTACTTTTGTGGTGATTGATGATGAAAATGCAAATGTTGATGTGGGGAGGGC...

Protein

Download Protein FASTA

224 aa · TkA06G057790|TK1151|PROTEIN

MGIIPKKKDENLDEIMNWVEWILSHSLLRIAESNPYGLDQFWLTQGEDLLLNLMQSFQEDVQERSATGLATFVVIDDENANVDVGRAEAVMKGGGIQLLLGLARSWKEGLQSEATKAIVNLSVNPAFAKAVAAGGGITIVASLARSMNRLVAEEAAGGLWNLSVGEEHKFELSDAPLESLHQTCAEVNSHLYQVKVVAEEMGIESTSCIYKPILDEHNFLETFK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G057790`
TK1151 ID	TkA06G057790
OH-1004 ID	LXL04_025468
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G057790

Location Chr06:15595793-15597872 (-)

Description Similar to FBX5: Protein ARABIDILLO 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60350`	Promotes lateral root initiation and development, independently of auxin (IAA) and abscisis acid (ABA).	No verified direct reference in this release
`At2g44900`	Promotes lateral root initiation and development, independently of auxin (IAA) and abscisis acid (ABA).	No verified direct reference in this release
`At4g23100`	Seems to play an important role in controlling the expression of resistance responses like the regulation of salicylic acid (SA) and phytoalexin (camalexin) production.	The ROOT MERISTEMLESS1/CADMIUM SENSITIVE2 gene defines a glutathione-dependent pathway involved in initiation and maintenance of cell division during postembryonic root development.2000 · DOI: 10.1105/tpc.12.1.97 The biological functions of glutathione revisited in arabidopsis transgenic plants with altered glutathione levels.2001 · DOI: 10.1104/pp.126.2.564 Level of glutathione is regulated by ATP-dependent ligation of glutamate and cysteine through photosynthesis in Arabidopsis thaliana: mechanism of strong interaction of light intensity with flowering.2004 · DOI: 10.1093/pcp/pch008 Evidence for a direct link between glutathione biosynthesis and stress defense gene expression in Arabidopsis.2004 · DOI: 10.1105/tpc.104.022608 Maturation of arabidopsis seeds is dependent on glutathione biosynthesis within the embryo.2006 · DOI: 10.1104/pp.106.077982 Identification of PAD2 as a gamma-glutamylcysteine synthetase highlights the importance of glutathione in disease resistance of Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2006.02938.x RML1 and RML2, Arabidopsis genes required for cell proliferation at the root tip.1995 · DOI: 10.1104/pp.107.2.365

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025468 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002213 defense response to insect Biological Process

GO:0006750 glutathione biosynthetic process Biological Process

GO:0009408 response to heat Biological Process

GO:0009700 indole phytoalexin biosynthetic process Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0009908 flower development Biological Process

GO:0010193 response to ozone Biological Process

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0048527 lateral root development Biological Process

GO:0050832 defense response to fungus Biological Process

KEGG gene cross-reference

ath:AT2G44900

ath:AT3G60350

ath:AT4G23100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.449

Rank 1 · TkA06G057790 · TK1151

Cytoplasm0.442

Rank 2 · TkA06G057790 · TK1151

Cell membrane0.089

Rank 3 · TkA06G057790 · TK1151

Endoplasmic reticulum0.064

Rank 4 · TkA06G057790 · TK1151

Mitochondrion0.060

Rank 5 · TkA06G057790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00514Arm49-69 aa

PF24768ARM_ARMC581-147 aa

PF00514Arm94-122 aa

PF00514Arm135-163 aa

PF04107GCS2163-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G057790	`PF00514`	Arm	49	69	2.3e-10	40.9
TkA06G057790	`PF24768`	ARM_ARMC5	81	147	0.02	15.0
TkA06G057790	`PF00514`	Arm	94	122	2.3e-10	40.9
TkA06G057790	`PF00514`	Arm	135	163	2.3e-10	40.9
TkA06G057790	`PF04107`	GCS2	163	207	0.00017	21.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M224`	Arabidopsis thaliana	sp\|Q9M224\|ADLO2_ARATH Protein ARABIDILLO 2	73.100%	Swiss-Prot	Medium
`O22161`	Arabidopsis thaliana	sp\|O22161\|ADLO1_ARATH Protein ARABIDILLO 1	72.800%	Swiss-Prot	Medium
`P46309`	Arabidopsis thaliana	sp\|P46309\|GSH1_ARATH Glutamate--cysteine ligase, chloroplastic	72.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card