RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G049950
Reference: TK1151 Chr: Chr06 Coordinates: 13597776-13599813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1473 bp · TkA06G049950|TK1151|cDNA

ATGGATTCATCAGAGAGGAATAATTCTCAATTGAAACAAGCACCCTGTTATTCAAACATCAAAACAAAGCTTTCGAAATCTCCATCTGTGATAGTAGTAGGTGGTGGCTTTGCTGGAATAGCTGCCGCCCGTGCCCTCCATGATGCTTCAATCCGGGTTATATTACTAGAGTCCCGTGACCGAATTGGTGGCCGAGTCCGTACAGATTACTCCTTTGGGTTTCCAGTGGATTTAGGGGCTTCGTGGTTACATGGAGTTTG...

CDS

Download CDS FASTA

1473 bp · TkA06G049950|TK1151|CDS

ATGGATTCATCAGAGAGGAATAATTCTCAATTGAAACAAGCACCCTGTTATTCAAACATCAAAACAAAGCTTTCGAAATCTCCATCTGTGATAGTAGTAGGTGGTGGCTTTGCTGGAATAGCTGCCGCCCGTGCCCTCCATGATGCTTCAATCCGGGTTATATTACTAGAGTCCCGTGACCGAATTGGTGGCCGAGTCCGTACAGATTACTCCTTTGGGTTTCCAGTGGATTTAGGGGCTTCGTGGTTACATGGAGTTTG...

Protein

Download Protein FASTA

490 aa · TkA06G049950|TK1151|PROTEIN

MDSSERNNSQLKQAPCYSNIKTKLSKSPSVIVVGGGFAGIAAARALHDASIRVILLESRDRIGGRVRTDYSFGFPVDLGASWLHGVCKENPLAPLIGRLGLPLYRTSGDNSVLYDHDLESYALFDVDGNQVPQELVTQVGETFENILQETNKIREEFTEDLSIHRAISLVFERNPNLTLQGLSHKVLQWYLCRMEGWFAADADTISLKCWDKEELLPGGHGLMVRGYQPVINTLAKGLDIRLSHPVKKINRRTNGVKVTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G049950
TK1151 IDTkA06G049950
OH-1004 IDLXL04_025590
Relationship / confidenceMulti Candidate From Tk1151 / Complex relationship
Protein identity (%)93.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G049950
LocationChr06:13597776-13599813 (-)
DescriptionSimilar to PAO2: Polyamine oxidase 2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g43020 Flavoenzyme involved in polyamine back-conversion.
Characterization of five polyamine oxidase isoforms in Arabidopsis thaliana.2010 · DOI: 10.1007/s00299-010-0881-1
Functional diversity inside the Arabidopsis polyamine oxidase gene family.2011 · DOI: 10.1093/jxb/erq341
POLYAMINE OXIDASE2 of Arabidopsis contributes to ABA mediated plant developmental processes.2015 · DOI: 10.1016/j.plaphy.2015.08.003
At3g59050 Flavoenzyme involved in polyamine back-conversion.
Bridging the gap between plant and mammalian polyamine catabolism: a novel peroxisomal polyamine oxidase responsible for a full back-conversion pathway in Arabidopsis.2008 · DOI: 10.1104/pp.108.123802
Characterization of five polyamine oxidase isoforms in Arabidopsis thaliana.2010 · DOI: 10.1007/s00299-010-0881-1
Spermidine oxidase-derived H₂O₂ regulates pollen plasma membrane hyperpolarization-activated Ca(2+) -permeable channels and pollen tube growth.2010 · DOI: 10.1111/j.1365-313x.2010.04301.x
Functional diversity inside the Arabidopsis polyamine oxidase gene family.2011 · DOI: 10.1093/jxb/erq341
At1g65840 Flavoenzyme involved in polyamine back-conversion.
A putative peroxisomal polyamine oxidase, AtPAO4, is involved in polyamine catabolism in Arabidopsis thaliana.2008 · DOI: 10.1093/pcp/pcn114
Characterization of five polyamine oxidase isoforms in Arabidopsis thaliana.2010 · DOI: 10.1007/s00299-010-0881-1
Functional diversity inside the Arabidopsis polyamine oxidase gene family.2011 · DOI: 10.1093/jxb/erq341
Global Metabolic Profiling of Arabidopsis Polyamine Oxidase 4 (AtPAO4) Loss-of-Function Mutants Exhibiting Delayed Dark-Induced Senescence.2016 · DOI: 10.3389/fpls.2016.00173

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0623300 Flavoenzyme involved in polyamine back-conversion.
Constitutively and highly expressed Oryza sativa polyamine oxidases localize in peroxisomes and catalyze polyamine back conversion.2012 · DOI: 10.1007/s00726-011-1002-3
Os04g0671300 Flavoenzyme involved in polyamine back-conversion.
Constitutively and highly expressed Oryza sativa polyamine oxidases localize in peroxisomes and catalyze polyamine back conversion.2012 · DOI: 10.1007/s00726-011-1002-3
Involvement of Polyamine Oxidase-Produced Hydrogen Peroxide during Coleorhiza-Limited Germination of Rice Seeds.2016 · DOI: 10.3389/fpls.2016.01219
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_025590 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006598 polyamine catabolic process Biological Process
GO:0046203 spermidine catabolic process Biological Process
GO:0046208 spermine catabolic process Biological Process
GO:1903602 thermospermine catabolic process Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0005777 peroxisome Cellular Component
GO:0046592 polyamine oxidase activity Molecular Function
GO:0050660 flavin adenine dinucleotide binding Molecular Function
GO:0052900 spermine oxidase (propane-1,3-diamine-forming) activity Molecular Function
GO:0052901 spermine oxidase activity Molecular Function
GO:0052903 N(1)-acetylpolyamine oxidase (3-acetamidopropanal-forming) activity Molecular Function
GO:1990534 thermospermine oxidase activity Molecular Function
KEGG gene cross-reference
ath:AT1G65840
ath:AT2G43020
ath:AT3G59050
dosa:Os04g0623300
dosa:Os04g0671200
osa:4337046
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.336
Rank 1 · TkA06G049950 · TK1151
Cytoplasm0.334
Rank 2 · TkA06G049950 · TK1151
Mitochondrion0.136
Rank 3 · TkA06G049950 · TK1151
Nucleus0.124
Rank 4 · TkA06G049950 · TK1151
Plastid0.106
Rank 5 · TkA06G049950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01262AlaDh_PNT_C28-60 aa
PF07992Pyr_redox_229-62 aa
PF03486HI0933_like29-67 aa
PF00070Pyr_redox29-63 aa
PF01946Thi429-64 aa
PF01494FAD_binding_329-61 aa
PF00890FAD_binding_230-73 aa
PF01266DAO30-64 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G049950PF01262AlaDh_PNT_C28600.2611.4
TkA06G049950PF07992Pyr_redox_229622.9e-0937.5
TkA06G049950PF03486HI0933_like29671.4e-0628.8
TkA06G049950PF00070Pyr_redox29630.0001523.0
TkA06G049950PF01946Thi429640.004517.0
TkA06G049950PF01494FAD_binding_329610.005616.7
TkA06G049950PF00890FAD_binding_230732.7e-0834.2
TkA06G049950PF01266DAO30647.8e-0833.0
TkA06G049950PF12831FAD_oxidored30652.2e-0627.9
TkA06G049950PF01134GIDA30638.6e-0625.8
TkA06G049950PF05834Lycopene_cycl30620.006616.3
TkA06G049950PF04820Trp_halogenase30590.489.9
TkA06G049950PF13738Pyr_redox_331598.7e-0522.6
TkA06G049950PF13450NAD_binding_832903.6e-1453.5
TkA06G049950PF13454NAD_binding_932660.000123.0
TkA06G049950PF01593Amino_oxidase374576.3e-98329.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SKX5Arabidopsis thalianasp|Q9SKX5|PAO2_ARATH Polyamine oxidase 279.000%Swiss-ProtHigh
Q9LYT1Arabidopsis thalianasp|Q9LYT1|PAO3_ARATH Polyamine oxidase 376.400%Swiss-ProtHigh
Q8H191Arabidopsis thalianasp|Q8H191|PAO4_ARATH Probable polyamine oxidase 462.300%Swiss-ProtHigh
Q7X809Oryza sativa subsp. japonicasp|Q7X809|PAO3_ORYSJ Polyamine oxidase 374.200%Swiss-ProtHigh
Q0J954Oryza sativa subsp. japonicasp|Q0J954|PAO5_ORYSJ Polyamine oxidase 565.100%Swiss-ProtHigh

JBrowse

View in Genome Browser