TkA06G047640 | RubberDandelionOmics

Gene overview

TkA06G047640

Reference: TK1151 Chr: Chr06 Coordinates: 12903160-12912176 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4621 bp · TkA06G047640|TK1151|cDNA

AAAGTTATTTTATACAAGATTCTATATGTATTGCCATTTTAATATTTTTGTTAATATATTTTGTGTGCCTACAAGGCTATAGGTATTTACTTCACAAAATACTCTATCACCACAGCCCCACTCGCTCTCTTTCATCCACCGCCTTAACAAAATCCCCTGTCCTTCCGCTTCCGGCTACGGAATCTTCCGAAACACAGACAACAGCCGTTTTACCCTTCGTAGTTTTCACCGGTGTTTCCGATCCCCTTACCTCCGCCCTT...

CDS

Download CDS FASTA

2358 bp · TkA06G047640|TK1151|CDS

ATGGCTCCTGGGCGGAAACGTGGAGGAGCAAAAGGAGCCAAAACAAAGAGTCAGTTAAATTTGGGCGATCTTGTTCTCGCTAAGGTCAAGGGTTTTCCTGCATGGCCTGCCAAGATCAGTAGACCTGAAGATTGGGAACGAGCTCCTGATCCAAAAAAATATTTTGTACAGTTCTTTGGTACCGAAGAAATAGCTTTTGTAGCTCCAGTTGATATTCAACCATTTACCAGTGAGTCAAAAAACAAATTACTAGATAGATG...

Protein

Download Protein FASTA

785 aa · TkA06G047640|TK1151|PROTEIN

MAPGRKRGGAKGAKTKSQLNLGDLVLAKVKGFPAWPAKISRPEDWERAPDPKKYFVQFFGTEEIAFVAPVDIQPFTSESKNKLLDRCKGKTVKYFSQAVKEICGIFEDLQNKSSDSLKDGTDGQSSQPDANSTEMVDDAMTTESYNDIVNHGPGLERCSHIHREREMGHEDMKPSVSPFVNDCSPSKKRIELSNDEVTSPNKNPTSGLKVETNGQKSNKIERASKKRHDGDDGLNKMHSPAQTNHLESTVSENSKDGIRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G047640`
TK1151 ID	TkA06G047640
OH-1004 ID	LXL04_025641
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 96.051 / OH-1004 61.360 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G047640

Location Chr06:12903160-12912176 (-)

Description Similar to HULK1: Protein HUA2-LIKE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23150`	Transcription factor that functions as a repressor of flowering by enhancing the expression of several genes that delay flowering including FLC, FLM/MAF1, MAF2 and SVP.	HUA1 and HUA2 are two members of the floral homeotic AGAMOUS pathway.1999 · DOI: 10.1016/s1097-2765(00)80462-1 Two RNA binding proteins, HEN4 and HUA1, act in the processing of AGAMOUS pre-mRNA in Arabidopsis thaliana.2003 · DOI: 10.1016/s1534-5807(02)00399-4 HUA2 is required for the expression of floral repressors in Arabidopsis thaliana.2005 · DOI: 10.1111/j.1365-313x.2004.02300.x Natural variation for anthocyanin accumulation under high-light and low-temperature stress is attributable to the ENHANCER OF AG-4 2 (HUA2) locus in combination with PRODUCTION OF ANTHOCYANIN PIGMENT1 (PAP1) and PAP2.2015 · DOI: 10.1111/nph.13177
`At5g08230`	Probable transcription factor that acts with partial redundancy with HULK2 and HULK3.	A plant-specific HUA2-LIKE (HULK) gene family in Arabidopsis thaliana is essential for development.2014 · DOI: 10.1111/tpj.12629
`At2g48160`	Probable transcription factor that acts with partial redundancy with HULK1 and HULK3.	A plant-specific HUA2-LIKE (HULK) gene family in Arabidopsis thaliana is essential for development.2014 · DOI: 10.1111/tpj.12629
`At3g63070`	Probable transcription factor that acts with partial redundancy with HULK1 and HULK2.	A plant-specific HUA2-LIKE (HULK) gene family in Arabidopsis thaliana is essential for development.2014 · DOI: 10.1111/tpj.12629

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025641 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009908 flower development Biological Process

GO:0005634 nucleus Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT2G48160

ath:AT3G63070

ath:AT5G08230

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.968

Rank 1 · TkA06G047640 · TK1151

Cytoplasm0.090

Rank 2 · TkA06G047640 · TK1151

Cell membrane0.026

Rank 3 · TkA06G047640 · TK1151

Endoplasmic reticulum0.012

Rank 4 · TkA06G047640 · TK1151

Mitochondrion0.008

Rank 5 · TkA06G047640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00855PWWP22-103 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G047640	`PF00855`	PWWP	22	103	2.6e-20	73.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XER9`	Arabidopsis thaliana	sp\|Q9XER9\|HUA2_ARATH ENHANCER OF AG-4 protein 2	34.000%	Swiss-Prot	Medium
`Q9LEY4`	Arabidopsis thaliana	sp\|Q9LEY4\|HUAL1_ARATH Protein HUA2-LIKE 1	33.000%	Swiss-Prot	Medium
`F4IN78`	Arabidopsis thaliana	sp\|F4IN78\|HUAL2_ARATH Protein HUA2-LIKE 2	50.800%	Swiss-Prot	Low
`F4IZM8`	Arabidopsis thaliana	sp\|F4IZM8\|HUAL3_ARATH Protein HUA2-LIKE 3	49.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card