TkA06G047360 | RubberDandelionOmics

Gene overview

TkA06G047360

Reference: TK1151 Chr: Chr06 Coordinates: 12828396-12836635 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5168 bp · TkA06G047360|TK1151|cDNA

GATAAATCAAAAACCACTTTTCACAAACATTACAAAAGTGATCCACTAACACTCCTCTAGTTTCGCCCGCCACCCAAGACTTGCGCCACAGCCCAAAACACGAACGCCTCCTTACCTTCGCTGTTTGGAACAACGTAGAACCAATGTCTTCTTAGGTTAAACCAATCAACACAAACAATTTTCAGCCCTTTTTCCATCCGATACTGAAGGTACCCAGATCCCTTTACCCCGTTCTTAAGAATCGACGCTCCCTCCCTCCC...

CDS

Download CDS FASTA

2181 bp · TkA06G047360|TK1151|CDS

ATGACATCAGAGTCAGAGGTTGATGACGAGGCAAGCAATGAGGAAGAGTGGACTAGCAGTGGTGAACCAGGGTCAGATGATGAAGATGTTGAAGCTCGTGCAGCTGAAGCCTTGAAGAAACTTGGTTCTGGACACCTTGAAGATTTTGCAAAAAATATTGCTGTTGTTGGGGGGACTTCTTCTGAATCACCAAAGCAAGAGGATGCAGAGGCTTCTGAGGACACAAAGGAGCCTTTAAAGAAAGGGGATCGTGTCAAGTA...

Protein

Download Protein FASTA

726 aa · TkA06G047360|TK1151|PROTEIN

MTSESEVDDEASNEEEWTSSGEPGSDDEDVEARAAEALKKLGSGHLEDFAKNIAVVGGTSSESPKQEDAEASEDTKEPLKKGDRVKYVGPSKHMEENNRIKLGSIATSDGTTNAYTVISRRPLVSGQRGEVYEINGDRVAVIMDSTEDDIEQPSKPSICWILGEHIERDFDTEAEDCYIAMQALSEVLCSVQPLIVYFPDSSLWLSRAVSKSNRKEFVNRLQEMFDQISGPVVLICGQNKVATGSKEKEKFTMILPNLGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G047360`
TK1151 ID	TkA06G047360
OH-1004 ID	LXL04_025649
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 71.865 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G047360`
Location	Chr06:12828396-12836635 (-)
Description	Similar to MSP1: Protein MSP1 (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025649` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002092 positive regulation of receptor internalization Biological Process GO:0006626 protein targeting to mitochondrion Biological Process GO:0034214 protein hexamerization Biological Process GO:0045047 protein targeting to ER Biological Process GO:0140570 extraction of mislocalized protein from mitochondrial outer membrane Biological Process GO:0005739 mitochondrion Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005778 peroxisomal membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0005524 ATP binding Molecular Function GO:0016887 ATP hydrolysis activity Molecular Function
KEGG gene cross-reference	bta:506045 hsa:84896 mmu:67979 rno:309532 sce:YGR028W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.484

Rank 1 · TkA06G047360 · TK1151

Nucleus0.325

Rank 2 · TkA06G047360 · TK1151

Mitochondrion0.127

Rank 3 · TkA06G047360 · TK1151

Cell membrane0.082

Rank 4 · TkA06G047360 · TK1151

Peroxisome0.070

Rank 5 · TkA06G047360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00005ABC_tran11-48 aa

PF13479AAA_2445-72 aa

PF23593HEAT_ATR191-228 aa

PF00004AAA210-239 aa

PF13401AAA_22215-235 aa

PF13479AAA_24217-259 aa

PF28514DUF8422298-372 aa

PF13238AAA_18310-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G047360	`PF00005`	ABC_tran	11	48	0.058	14.7
TkA06G047360	`PF13479`	AAA_24	45	72	0.11	12.9
TkA06G047360	`PF23593`	HEAT_ATR	191	228	0.16	12.6
TkA06G047360	`PF00004`	AAA	210	239	2e-37	129.3
TkA06G047360	`PF13401`	AAA_22	215	235	0.00012	23.1
TkA06G047360	`PF13479`	AAA_24	217	259	0.11	12.9
TkA06G047360	`PF28514`	DUF8422	298	372	0.23	12.0
TkA06G047360	`PF13238`	AAA_18	310	354	0.0068	17.6
TkA06G047360	`PF20720`	nSTAND3	312	335	0.0065	16.9
TkA06G047360	`PF07728`	AAA_5	321	341	0.0021	18.8
TkA06G047360	`PF24933`	DUF7751	337	390	3e-06	28.2
TkA06G047360	`PF28514`	DUF8422	394	419	0.23	12.0
TkA06G047360	`PF13173`	AAA_14	411	452	0.0043	17.8
TkA06G047360	`PF02367`	TsaE	468	499	0.15	12.7
TkA06G047360	`PF20720`	nSTAND3	469	498	0.0065	16.9
TkA06G047360	`PF12775`	AAA_7	469	499	0.18	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card