TkA06G047000 | RubberDandelionOmics

Gene overview

TkA06G047000

Reference: TK1151 Chr: Chr06 Coordinates: 12690144-12695081 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2500 bp · TkA06G047000|TK1151|cDNA

CCTAAATTGAGTTAAAAACTTGAATCCGTGACTCAAAACCTTTGGATATATGTTAGTTTATAGCAGCCTACACCATATTTGCCAAAGCAATGTTTCATGTGCTACAAAATGTACTCTTGTTTTTTGCCAACGCATACTCTCCTCTCGTGAGTCATTATTCCTATAATTGATGTGGTCCTAAAATAAGAAAAACACACTCATGGATTGAGTAGTAGAACTCCTTCACTTCCACATTCAATGCGAACAACTTAACTACAAGC...

CDS

Download CDS FASTA

1464 bp · TkA06G047000|TK1151|CDS

ATGGCAGAACTCTGTGATTTGCAGGTCCATATCAATGGTCAACAAACATTCTATCTCCACGAGAAAACAATATCAAGATTCTCGGGGAAGTTAAGGAAGATGATTAAGAAAGAAAAGAGAAAAACCCAGATCAGAAAAACCGGAATCGAGATCAATGATTTCCCTGGTGGCTCAGATGGGTTTGAATTGTTTTCAAGATTCTGCTACAACAATGGCGAAATCAACATCTCCGTATGCAATGTCTCTCTCCTCCATTGTTG...

Protein

Download Protein FASTA

487 aa · TkA06G047000|TK1151|PROTEIN

MAELCDLQVHINGQQTFYLHEKTISRFSGKLRKMIKKEKRKTQIRKTGIEINDFPGGSDGFELFSRFCYNNGEINISVCNVSLLHCCAVFLAMNDTLLPKTTDVFNRMFDWSLTDVIICLKNCTPFITYADSTGIIEKLISSLIIKITQNSDSNSISTNLFPSSSSSSSPESTVKSCTLLRLSSCSSTKGLFWFDDMAVLPPAIIERFVKALGAYGNENNSLVVTRFLLHYLKTACQSKTRSFSKCDYGGLADTAVYGVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G047000`
TK1151 ID	TkA06G047000
OH-1004 ID	LXL04_025666
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 80.903 / OH-1004 69.611 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G047000

Location Chr06:12690144-12695081 (+)

Description Similar to At3g19850: BTB/POZ domain-containing protein At3g19850

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50280`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g19850`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g50840`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At2g47860`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g03010`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0568200`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	The Rice COLEOPTILE PHOTOTROPISM1 gene encoding an ortholog of Arabidopsis NPH3 is required for phototropism of coleoptiles and lateral translocation of auxin.2005 · DOI: 10.1105/tpc.104.028357

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025666 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0031463 Cul3-RING ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT1G30440

ath:AT1G50280

ath:AT3G19850

ath:AT3G22104

ath:AT5G03250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.786

Rank 1 · TkA06G047000 · TK1151

Cytoplasm0.214

Rank 2 · TkA06G047000 · TK1151

Cell membrane0.046

Rank 3 · TkA06G047000 · TK1151

Endoplasmic reticulum0.038

Rank 4 · TkA06G047000 · TK1151

Mitochondrion0.021

Rank 5 · TkA06G047000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651BTB3-94 aa

PF29739FslL_N63-106 aa

PF03000NPH3124-151 aa

PF29739FslL_N146-188 aa

PF03000NPH3192-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G047000	`PF00651`	BTB	3	94	0.046	14.6
TkA06G047000	`PF29739`	FslL_N	63	106	0.49	11.2
TkA06G047000	`PF03000`	NPH3	124	151	8.9e-43	147.5
TkA06G047000	`PF29739`	FslL_N	146	188	0.49	11.2
TkA06G047000	`PF03000`	NPH3	192	395	8.9e-43	147.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXR6`	Arabidopsis thaliana	sp\|Q8RXR6\|Y1028_ARATH BTB/POZ domain-containing protein At1g50280	51.900%	Swiss-Prot	High
`Q9LT24`	Arabidopsis thaliana	sp\|Q9LT24\|Y3985_ARATH BTB/POZ domain-containing protein At3g19850	50.400%	Swiss-Prot	High
`Q8LPQ3`	Arabidopsis thaliana	sp\|Q8LPQ3\|Y3084_ARATH BTB/POZ domain-containing protein At3g50840	28.300%	Swiss-Prot	Low
`O82253`	Arabidopsis thaliana	sp\|O82253\|SETH6_ARATH BTB/POZ domain-containing protein SETH6	26.300%	Swiss-Prot	Low
`Q9SA69`	Arabidopsis thaliana	sp\|Q9SA69\|Y1301_ARATH BTB/POZ domain-containing protein At1g03010	27.200%	Swiss-Prot	Low
`Q5KS50`	Oryza sativa subsp. japonica	sp\|Q5KS50\|NPH3_ORYSJ Coleoptile phototropism protein 1	42.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card