TkA06G043640 | RubberDandelionOmics

Gene overview

TkA06G043640

Reference: TK1151 Chr: Chr06 Coordinates: 11808909-11814386 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3408 bp · TkA06G043640|TK1151|cDNA

CCGCAAGGTCATACCGTCCATATTGACGTACCTGAGCTCAGGAGTCCCTATAATCCTATCACTAATAACTCGTTGTTAAAAGCTCGTTGGCCCGTGATCCGATGAAGGGTTTCGGCATATCGGAGATCTGGTTTGTTTCTTGTCAACGAGATTTCCGTAAATCGTTTGACAGCTTCACTTGTGTCGACCATGGAAGACCTCAAGCCGCTAAATACCATCGCTGATTCCTCTACAGAAACCGGAGCTACCTTTGAAGCTCG...

CDS

Download CDS FASTA

2946 bp · TkA06G043640|TK1151|CDS

ATGGAAGACCTCAAGCCGCTAAATACCATCGCTGATTCCTCTACAGAAACCGGAGCTACCTTTGAAGCTCGATTTAGCGACTTTTGCAAGGGTCGATTAACAATGGATGATAACGCTTTAGAAGAAGCGATGAAGCTCTTCAATAAAAGCAAACACCTTTTCTTGACAAATGCATCCAGTCTTGGAACTGGGACGCCTGAAGAAGCCGAGCACTACTGGTTTGCATTTCTCTTATTCTCCTTAAAAAGATTAAGCCAGAA...

Protein

Download Protein FASTA

981 aa · TkA06G043640|TK1151|PROTEIN

MEDLKPLNTIADSSTETGATFEARFSDFCKGRLTMDDNALEEAMKLFNKSKHLFLTNASSLGTGTPEEAEHYWFAFLLFSLKRLSQKNDSEDATVTNENAFKLYQILRVAKLNFVDFFKELPQFIVKIGPILSNLYGSDWETRLQAKELQANFVHLSLLSKYYKRAFKALFLASLENVEGQSTVATSSDYMSNCHRFGWLLFLALRVHAFSRFKDLVTCTNGLVSILAILIIHIPARFRNFSLNDSSRFVKKEGKGVDLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G043640`
TK1151 ID	TkA06G043640
OH-1004 ID	LXL04_025708
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G043640`
Location	Chr06:11808909-11814386 (+)
Description	Similar to RBR: Retinoblastoma-related protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025708` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0030154 cell differentiation Biological Process GO:0032875 regulation of DNA endoreduplication Biological Process GO:2000134 negative regulation of G1/S transition of mitotic cell cycle Biological Process GO:0000785 chromatin Cellular Component GO:0005634 nucleus Cellular Component GO:0005667 transcription regulator complex Cellular Component GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding Molecular Function
KEGG gene cross-reference	rcu:8283405 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.929

Rank 1 · TkA06G043640 · TK1151

Cytoplasm0.168

Rank 2 · TkA06G043640 · TK1151

Mitochondrion0.024

Rank 3 · TkA06G043640 · TK1151

Cell membrane0.021

Rank 4 · TkA06G043640 · TK1151

Golgi apparatus0.010

Rank 5 · TkA06G043640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11934DUF345295-233 aa

PF08934Rb_C386-409 aa

PF01858RB_A401-595 aa

PF27452KefB_C539-578 aa

PF11934DUF3452552-584 aa

PF11934DUF3452699-734 aa

PF01857RB_B703-828 aa

PF08934Rb_C860-912 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G043640	`PF11934`	DUF3452	95	233	3.6e-34	118.1
TkA06G043640	`PF08934`	Rb_C	386	409	0.11	13.0
TkA06G043640	`PF01858`	RB_A	401	595	4.1e-62	210.3
TkA06G043640	`PF27452`	KefB_C	539	578	0.18	12.8
TkA06G043640	`PF11934`	DUF3452	552	584	3.6e-34	118.1
TkA06G043640	`PF11934`	DUF3452	699	734	3.6e-34	118.1
TkA06G043640	`PF01857`	RB_B	703	828	3.2e-40	138.1
TkA06G043640	`PF08934`	Rb_C	860	912	0.11	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card