TkA06G041850 | RubberDandelionOmics

Gene overview

TkA06G041850

Reference: TK1151 Chr: Chr06 Coordinates: 11318061-11320391 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1229 bp · TkA06G041850|TK1151|cDNA

CCGATGGACAAAATCCAACATCCAACAAAGTATGAACTTTATAAAAAAAACATTGGATTTGAACGATTCGTCTCTACTCGAGTGTTGTTTAATGGCCAATTGGGCATAAAGGTAAAACAAAGCAAAGCAAAAGGGGTGGTTTATTTGCTGCATTCATAAAGCTTCGAAATCCCCGCCTTCTCCTTCTTCCTCATCCTCATCTCTATATCTCAACTTTCCATCATCTTTCCTATTTTCCACTTTATTCCTGCTTACTGCAC...

CDS

Download CDS FASTA

738 bp · TkA06G041850|TK1151|CDS

ATGGCGAGCATCAGCACCTCCTTGGAAGATGTACCTTCTACCGACATCATGACTGAACTCCTCCGCCGACTCAAGTGCTCATCCAAGCCCGATAAGCGCCTCATCCTCATTGGTCCACCCGGATCTGGAAAAGGTACCCAATCGCCCATCATCAAGGACGAATTCTGCCTATGCCACCTGGCAACCGGTGATATGTTGAGAGCAGCCGTCGCTGCTAAAACCCCACTCGGTATCAAAGCCAAAGAAACCATGGAGAAGGG...

Protein

Download Protein FASTA

245 aa · TkA06G041850|TK1151|PROTEIN

MASISTSLEDVPSTDIMTELLRRLKCSSKPDKRLILIGPPGSGKGTQSPIIKDEFCLCHLATGDMLRAAVAAKTPLGIKAKETMEKGELVSDDLVVGIIDEAMKKPSCQKGFILDGFPRTVAQAEKLDEMLQKQGTKIDKVLDFAINDSILEERITGRWIHASSGRTYHTKFAPPKTPGVDDVTGEPLMQRKDDTAQVLKSRLEAFHRQTEPVIEYYNKKGVVAKLPAEKPPKEVTVEVQKVLST

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G041850`
TK1151 ID	TkA06G041850
OH-1004 ID	LXL04_025771
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G041850

Location Chr06:11318061-11320391 (-)

Description Similar to ADK-B: Adenylate kinase 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63400`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release
`At5g50370`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q08480`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release
`Os12g0236400`	Catalyzes the reversible transfer of the terminal phosphate group between ATP and AMP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025771 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006163 purine nucleotide metabolic process Biological Process

GO:0006172 ADP biosynthetic process Biological Process

GO:0046033 AMP metabolic process Biological Process

GO:0046034 ATP metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005758 mitochondrial intermembrane space Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0004017 AMP kinase activity Molecular Function

GO:0005507 copper ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G50370

ath:AT5G63400

dmo:Dmoj_GI20701

dosa:Os11g0312400

dosa:Os12g0236400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.583

Rank 1 · TkA06G041850 · TK1151

Cytoplasm0.331

Rank 2 · TkA06G041850 · TK1151

Nucleus0.125

Rank 3 · TkA06G041850 · TK1151

Plastid0.088

Rank 4 · TkA06G041850 · TK1151

Peroxisome0.068

Rank 5 · TkA06G041850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05496RuvB_N32-56 aa

PF13671AAA_3334-158 aa

PF17213Hydin_ADK34-82 aa

PF00406ADK36-221 aa

PF13207AAA_1737-157 aa

PF17213Hydin_ADK91-116 aa

PF05191ADK_lid158-193 aa

PF05496RuvB_N183-201 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G041850	`PF05496`	RuvB_N	32	56	0.25	11.8
TkA06G041850	`PF13671`	AAA_33	34	158	0.0023	18.9
TkA06G041850	`PF17213`	Hydin_ADK	34	82	0.29	11.9
TkA06G041850	`PF00406`	ADK	36	221	7.4e-60	202.2
TkA06G041850	`PF13207`	AAA_17	37	157	1.2e-24	87.9
TkA06G041850	`PF17213`	Hydin_ADK	91	116	0.29	11.9
TkA06G041850	`PF05191`	ADK_lid	158	193	1.4e-16	60.8
TkA06G041850	`PF05496`	RuvB_N	183	201	0.25	11.8
TkA06G041850	`PF13671`	AAA_33	188	214	0.0023	18.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82514`	Arabidopsis thaliana	sp\|O82514\|KAD4_ARATH Adenylate kinase 4	79.600%	Swiss-Prot	High
`Q9FK35`	Arabidopsis thaliana	sp\|Q9FK35\|KAD3_ARATH Adenylate kinase 3	75.800%	Swiss-Prot	High
`Q08480`	Oryza sativa subsp. japonica	sp\|Q08480\|KAD4_ORYSJ Adenylate kinase 4	86.700%	Swiss-Prot	High
`Q08479`	Oryza sativa subsp. japonica	sp\|Q08479\|KAD3_ORYSJ Adenylate kinase 3	85.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card