Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1463 bp · TkA06G041590|TK1151|cDNA
CCTCGATCAACAGATACAAAACTTCCACATATTATCCATTTGACTGCAAATTTCAACCTATAATGTAGATTTTTGCTGATTATATGATTACATTATAAACCCTTGTTGGCGTTGAGTGGTAGCTCTCACTGAAACAATTTGAATTTCCAAATGTTTTCACCTGCTGCAAAACCTCAAGCGATCAATTTTTACCCACCACAAGAAACAATCATGATGATGGAATCCACCTCCACCCCTCACCACCACCAAACCCAAATGAT...
1143 bp · TkA06G041590|TK1151|CDS
ATGTTTTCACCTGCTGCAAAACCTCAAGCGATCAATTTTTACCCACCACAAGAAACAATCATGATGATGGAATCCACCTCCACCCCTCACCACCACCAAACCCAAATGATCATTTCCGCTCCGGTTGCCGGCGGCGACACCACCAGCAGCGAAGAAAACACCATCAAGTCCTCAACCGCGACAACCTCAGCACCAGTGAAGAAACGAGCCGAGACTTGGGTCAAAGAAGAAACTCGAACCCTAATCCTCCTTCGCCACGA...
Protein
Download Protein FASTA380 aa · TkA06G041590|TK1151|PROTEIN
MFSPAAKPQAINFYPPQETIMMMESTSTPHHHQTQMIISAPVAGGDTTSSEENTIKSSTATTSAPVKKRAETWVKEETRTLILLRHEIDSLFNTSKSNKHLWDQISMKMREKGFDRSPTMCTDKWRNLLKEFKKAKEQNNGVSHNGYSANSKMQFYKEVEDVIRDRNKNSKVDSFMQFSDKGVDDTGITFGPVEANPRDALNLERRLDQEGHPLAITGADTMAATGVSPWNWRENPGNGDQNNTYGGRVISVKLGDYTRR...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G041590 |
|---|---|
| TK1151 ID | TkA06G041590 |
| OH-1004 ID | LXL04_025779 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G041590 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:11257058-11259117 (+) | |||||||||
| Description | Similar to GT-1: Trihelix transcription factor GT-1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0019760 glucosinolate metabolic process Biological Process GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process GO:0048358 mucilage pectin biosynthetic process Biological Process GO:0048768 root hair cell tip growth Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0016592 mediator complex Cellular Component GO:0000976 transcription cis-regulatory region binding Molecular Function GO:0000987 cis-regulatory region sequence-specific DNA binding Molecular Function GO:0003677 DNA binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT1G13450 ath:AT1G76880 ath:AT2G38250 ath:AT3G25990 ath:AT5G01380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13837Myb_DNA-bind_472-161 aaPF13921Myb_DNA-bind_673-133 aaPF00249Myb_DNA-binding73-129 aaPF10545MADF_DNA_bdg92-158 aaPF26214Ubiquitin_GT-1154-176 aaPF26214Ubiquitin_GT-1248-308 aaPF26214Ubiquitin_GT-1313-378 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G041590 | PF13837 | Myb_DNA-bind_4 | 72 | 161 | 3.1e-21 | 76.3 |
| TkA06G041590 | PF13921 | Myb_DNA-bind_6 | 73 | 133 | 0.002 | 19.0 |
| TkA06G041590 | PF00249 | Myb_DNA-binding | 73 | 129 | 0.17 | 12.8 |
| TkA06G041590 | PF10545 | MADF_DNA_bdg | 92 | 158 | 0.0002 | 22.3 |
| TkA06G041590 | PF26214 | Ubiquitin_GT-1 | 154 | 176 | 5.6e-43 | 145.4 |
| TkA06G041590 | PF26214 | Ubiquitin_GT-1 | 248 | 308 | 5.6e-43 | 145.4 |
| TkA06G041590 | PF26214 | Ubiquitin_GT-1 | 313 | 378 | 5.6e-43 | 145.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.