TkA06G040220 | RubberDandelionOmics

Gene overview

TkA06G040220

Reference: TK1151 Chr: Chr06 Coordinates: 10861434-10864156 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2009 bp · TkA06G040220|TK1151|cDNA

TTGTGGTCTACCCAAAGTGAATTAAAATCAAGTTTTTACAGATTTTGTGGTCTTAAAAAAGACATAGAGAAGATTTGAAGATTCAGAACTTGGGATATGAATTATGATCAATCGTTTTGGCTTAAGTGGTTTATCTCTTTGTCTGAAATCTGAATGCATCCCAACATAACTAATATACGGTGTCGTATCATCGTTATCTGGTAGAGGTTAGGCTCCCTCGTCTTTTTTTTTCATCAGCAGGTAAACGAACCACACTCATC...

CDS

Download CDS FASTA

1101 bp · TkA06G040220|TK1151|CDS

ATGGCGATTTTAGCGTGTCTCCCAAACCCTAATCTCTTCTCCTCCCTCCCCACACCCACATCCCCACCACCTCCGAACACAATCAAACCCCCAATTCCAATTCCCAAATATCCACCAGTCCGCAAAACCCAAAAACCACCACCACCAAACCCCCAATCCAACCCCGCCTTCAAAACCTTCCACCGCCGCTCCAAATACTACAAACCTATCAGAGACGGTGACGTCGTTTCCTCCGAAGGCGACCGGTCCGTCGTCGTTGG...

Protein

Download Protein FASTA

366 aa · TkA06G040220|TK1151|PROTEIN

MAILACLPNPNLFSSLPTPTSPPPPNTIKPPIPIPKYPPVRKTQKPPPPNPQSNPAFKTFHRRSKYYKPIRDGDVVSSEGDRSVVVGESGVSYQLPGAPFEFQYSYSEIPRAKPIAIREPAFLPFAPPTMPRPWTGKAPLKKSTRKIKLFESLNPSNNAKQLEMLKPYELGNFEVRPREEVLGKPLNRAERLELVKPHISSNRQVNLGRDGLTHNMLELIHSHWRRDPVCKVRCLGVPTVDMRNVCRVLQEKTGGKIILK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G040220`
TK1151 ID	TkA06G040220
OH-1004 ID	LXL04_027948
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	55.900
Protein coverage (%)	TK1151 77.869 / OH-1004 44.892 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G040220

Location Chr06:10861434-10864156 (+)

Description Similar to At2g20020: CRS2-associated factor 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23400`	Essential protein required for the splicing of group IIB introns in chloroplasts.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0323300`	Required for the splicing of group IIB introns in chloroplasts.	No verified direct reference in this release
`Os01g0495900`	Required for the splicing of group IIB introns in chloroplasts.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027948 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G23400

ath:AT2G20020

dosa:Os01g0495900

zma:542118

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.903

Rank 1 · TkA06G040220 · TK1151

Mitochondrion0.084

Rank 2 · TkA06G040220 · TK1151

Nucleus0.059

Rank 3 · TkA06G040220 · TK1151

Cytoplasm0.028

Rank 4 · TkA06G040220 · TK1151

Cell membrane0.011

Rank 5 · TkA06G040220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01985CRS1_YhbY186-269 aa

PF01985CRS1_YhbY304-354 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G040220	`PF01985`	CRS1_YhbY	186	269	1.5e-28	99.7
TkA06G040220	`PF01985`	CRS1_YhbY	304	354	1.5e-28	99.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDA9`	Arabidopsis thaliana	sp\|Q9LDA9\|CAF2P_ARATH CRS2-associated factor 2, chloroplastic	59.800%	Swiss-Prot	High
`Q657G7`	Oryza sativa subsp. japonica	sp\|Q657G7\|CAF2P_ORYSJ CRS2-associated factor 2, chloroplastic	57.100%	Swiss-Prot	High
`Q5VMQ5`	Oryza sativa subsp. japonica	sp\|Q5VMQ5\|CAF1P_ORYSJ CRS2-associated factor 1, chloroplastic	53.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card