RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G040180
Reference: TK1151 Chr: Chr06 Coordinates: 10850497-10853696 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1404 bp · TkA06G040180|TK1151|cDNA

AAGAAGAAGAAGGCGCATTTTAATATTTATGTCTCAACGTCCATCCATCCATCCATCCATCACCCCCCCGTTTGCGTAACCACCACCACCGCACCGATCGATTATCTCTCTCTCATCACTCATCAACCTCTTTTTGATGGAGTTTTTGTTGCGGATTTTGAGTTTTTGAAGTGATTTCAGTTGATATATAGATTGTTCGGCTTGAGGATTTGCAGGATCGACTGAAGATTTTTGGTGGTTGTTGTTGTTGAGGTGGATTG...

CDS

Download CDS FASTA

585 bp · TkA06G040180|TK1151|CDS

ATGTTGGGAGGAAATAACAACAATTCATTACTCCCTGTCTTTGTTGATGGGAGCCTTTTTCAGTATCCTTCAAACACATCAAACCAATTGCAACTATTTGGAAATGGTGGATGTAATGTTGATCAAGTAAATTATTCAGCAAGAGAGCATAACAGCCCTGTTTTTAGACCTAACAAAAGACCAAGGGAAATCGAAGCTAATTTTATGCAAAAAAAGCTTCAGATTTCATTGAACCATAATTTCTATAATAATGACGATAT...

Protein

Download Protein FASTA

194 aa · TkA06G040180|TK1151|PROTEIN

MLGGNNNNSLLPVFVDGSLFQYPSNTSNQLQLFGNGGCNVDQVNYSAREHNSPVFRPNKRPREIEANFMQKKLQISLNHNFYNNDDIAPSTIPNPHHVSTGLKLSYDDEERNSSITSASASMTLAPSIMSSFGDSISTELERHKDEFERYLIIQEENMLKGMSDIRQRHMTSFISTMEKNIHNKLREKKQKSKP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G040180
TK1151 IDTkA06G040180
OH-1004 IDLXL04_025838
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)100.000
Protein coverage (%)TK1151 96.907 / OH-1004 54.493
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G040180
LocationChr06:10850497-10853696 (+)
DescriptionSimilar to BOI: E3 ubiquitin-protein ligase BOI
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_025838 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000209 protein polyubiquitination Biological Process
GO:0001666 response to hypoxia Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0006952 defense response Biological Process
GO:0007166 cell surface receptor signaling pathway Biological Process
GO:0007249 canonical NF-kappaB signal transduction Biological Process
GO:0009739 response to gibberellin Biological Process
GO:0031398 positive regulation of protein ubiquitination Biological Process
GO:0033209 tumor necrosis factor-mediated signaling pathway Biological Process
GO:0034121 regulation of toll-like receptor signaling pathway Biological Process
GO:0038061 non-canonical NF-kappaB signal transduction Biological Process
GO:0039535 regulation of RIG-I signaling pathway Biological Process
KEGG gene cross-reference
ath:AT1G79110
ath:AT3G12920
ath:AT4G19700
ath:AT5G45100
hsa:329
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.959
Rank 1 · TkA06G040180 · TK1151
Cytoplasm0.134
Rank 2 · TkA06G040180 · TK1151
Cell membrane0.022
Rank 3 · TkA06G040180 · TK1151
Endoplasmic reticulum0.012
Rank 4 · TkA06G040180 · TK1151
Plastid0.009
Rank 5 · TkA06G040180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser