TkA06G039820 | RubberDandelionOmics

Gene overview

TkA06G039820

Reference: TK1151 Chr: Chr06 Coordinates: 10744789-10745952 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1164 bp · TkA06G039820|TK1151|cDNA

ATGTCAGATTATCTAGGTGAAGAGTTGATTGTTGAGATATTCAGAAGACTACCGCTCAAATCCCTCCTCCGATTTACATCACTTTGCAAATCATTACGTTCTTGTATTGCTAGCTCTCATTTCACCTGCATGCATGCTTCTCGATCCCCCAAAAGACTCATTATTAAACACCAACTCATAGATAAAAGCACACAAAGATATGACTACGAAATCTTTCATACGTTACATTCAGTAGACGATTTGTCCATGTGTCCACTACG...

CDS

Download CDS FASTA

1164 bp · TkA06G039820|TK1151|CDS

ATGTCAGATTATCTAGGTGAAGAGTTGATTGTTGAGATATTCAGAAGACTACCGCTCAAATCCCTCCTCCGATTTACATCACTTTGCAAATCATTACGTTCTTGTATTGCTAGCTCTCATTTCACCTGCATGCATGCTTCTCGATCCCCCAAAAGACTCATTATTAAACACCAACTCATAGATAAAAGCACACAAAGATATGACTACGAAATCTTTCATACGTTACATTCAGTAGACGATTTGTCCATGTGTCCACTACG...

Protein

Download Protein FASTA

387 aa · TkA06G039820|TK1151|PROTEIN

MSDYLGEELIVEIFRRLPLKSLLRFTSLCKSLRSCIASSHFTCMHASRSPKRLIIKHQLIDKSTQRYDYEIFHTLHSVDDLSMCPLRYCVKFPTRTTFIVGSCNGIICLHDNQKGMISLWNPSIRRQLTLPRITLPDCSQRFPYRIVIGFGFDPITYDNKIVSIRKYGENVESSFIYSMKTGDWRPISTPMPFYSYVSSSACFVKGVLHWAVFTNSKDVDPWYILTFDLNTHVFGMIALPKPSWRFHKLTIIQDSLAVIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G039820`
TK1151 ID	TkA06G039820
OH-1004 ID	LXL04_025292
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	52.100
Protein coverage (%)	TK1151 84.755 / OH-1004 51.757 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G039820

Location Chr06:10744789-10745952 (-)

Description Similar to At3g06240: F-box/kelch-repeat protein At3g06240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07870`	F-box protein At3g07870.	No verified direct reference in this release
`At5g49610`	F-box protein At5g49610.	No verified direct reference in this release
`At1g12870`	Putative F-box/kelch-repeat protein At1g12870.	No verified direct reference in this release
`At3g23960`	Putative F-box protein At3g23960.	No verified direct reference in this release
`At1g26515`	Putative F-box protein At1g26515.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025292 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G47790

ath:AT3G06240

ath:AT3G10240

ath:AT3G16210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.584

Rank 1 · TkA06G039820 · TK1151

Nucleus0.486

Rank 2 · TkA06G039820 · TK1151

Cell membrane0.084

Rank 3 · TkA06G039820 · TK1151

Endoplasmic reticulum0.058

Rank 4 · TkA06G039820 · TK1151

Mitochondrion0.029

Rank 5 · TkA06G039820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box7-42 aa

PF12937F-box-like7-38 aa

PF08268FBA_384-310 aa

PF03478Beta-prop_KIB1-489-241 aa

PF24750b-prop_At3g26010-like93-244 aa

PF07734FBA_198-279 aa

PF22778VCPO_2nd178-216 aa

PF12063ATG1-like_MIT1321-386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G039820	`PF00646`	F-box	7	42	6.4e-08	32.9
TkA06G039820	`PF12937`	F-box-like	7	38	0.00029	21.2
TkA06G039820	`PF08268`	FBA_3	84	310	3.3e-23	82.9
TkA06G039820	`PF03478`	Beta-prop_KIB1-4	89	241	2.4e-05	24.7
TkA06G039820	`PF24750`	b-prop_At3g26010-like	93	244	1.4e-05	25.1
TkA06G039820	`PF07734`	FBA_1	98	279	4.3e-13	49.7
TkA06G039820	`PF22778`	VCPO_2nd	178	216	0.047	14.2
TkA06G039820	`PF12063`	ATG1-like_MIT1	321	386	0.25	12.0
TkA06G039820	`PF12937`	F-box-like	339	348	0.00029	21.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SFC7`	Arabidopsis thaliana	sp\|Q9SFC7\|FB135_ARATH F-box protein At3g07870	28.800%	Swiss-Prot	Low
`Q9FGY4`	Arabidopsis thaliana	sp\|Q9FGY4\|FB341_ARATH F-box protein At5g49610	25.100%	Swiss-Prot	Low
`Q9LPW2`	Arabidopsis thaliana	sp\|Q9LPW2\|FBK2_ARATH Putative F-box/kelch-repeat protein At1g12870	27.300%	Swiss-Prot	Low
`Q9LIR1`	Arabidopsis thaliana	sp\|Q9LIR1\|FB182_ARATH Putative F-box protein At3g23960	22.200%	Swiss-Prot	Low
`Q9FZD6`	Arabidopsis thaliana	sp\|Q9FZD6\|FB306_ARATH Putative F-box protein At1g26515	25.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card