TkA06G039600 | RubberDandelionOmics

Gene overview

TkA06G039600

Reference: TK1151 Chr: Chr06 Coordinates: 10696758-10701395 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2999 bp · TkA06G039600|TK1151|cDNA

TTGGTGTCGAGCCCTAACATATAGACTGAAATGTGTGCCGACCTTTTAAATCTGAATCCATTATCCAAACAAAATAAAGGCGGCCCGTCAGCATATACTCGGCATTTTCAATCCTTGTTGATACTCCCAAGAAAAAACTACACTCGCTGACTTATTTCGTCTCTTTCTCACTGCTTCTGATTTCAGACGAAAGTTGTTTTCTTTTTCGATACAAGATGGCTCTGAATACGGATGAGCTTGTAGGAAAATCGAATTCAGCA...

CDS

Download CDS FASTA

939 bp · TkA06G039600|TK1151|CDS

ATGGGCCCTCAGGTGTTCAATTGTGGGGCCCCTGATACCGGAAATATGGAGGTTTTATTGCGATATGGAAACAAAGAGCAACTTCAAGAGTGGCTTATTCCATTGCTTAATGGAACAATTAGGTCTGGATTTGCGATGACAGAACCTCAAGTTGCTTCATCGGATGCGACTAATATAGAATGTTCTATCAAAAGAGATGGAGATACGTATGTTATAAATGGAAGAAAATGGTGGACAAGTGGAGCCATGGATCCTAGATG...

Protein

Download Protein FASTA

312 aa · TkA06G039600|TK1151|PROTEIN

MGPQVFNCGAPDTGNMEVLLRYGNKEQLQEWLIPLLNGTIRSGFAMTEPQVASSDATNIECSIKRDGDTYVINGRKWWTSGAMDPRCKLLILMGKTDFNAPIHKQQSMILVDINTPGVKIIRPLMVFGFDDAPHGHAEITFENVRVPAKNILLGEGRGFEIAQGRLGPGRLHHCMRLIGAAERGMQLMVQRALQRKTFGKYIAQHGSFLSDLAKCRIELERTRLLVFEAADQLDRHGNKKARGTLAMAKVAAPDMALKVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G039600`
TK1151 ID	TkA06G039600
OH-1004 ID	LXL04_025998
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.359 / OH-1004 39.541 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G039600

Location Chr06:10696758-10701395 (-)

Description Similar to IBR3: Probable acyl-CoA dehydrogenase IBR3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8RWZ3`	Involved with IBR1 and IBR10 in the peroxisomal beta-oxidation of indole-3-butyric acid (IBA) to form indole-3-acetic acid (IAA), a biologically active auxin.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025998 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0033539 fatty acid beta-oxidation using acyl-CoA dehydrogenase Biological Process

GO:0048767 root hair elongation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0003995 acyl-CoA dehydrogenase activity Molecular Function

GO:0004466 long-chain fatty acyl-CoA dehydrogenase activity Molecular Function

KEGG gene cross-reference

ath:AT3G06810

gga:420689

hsa:80724

hsa:84129

mmu:71985

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.595

Rank 1 · TkA06G039600 · TK1151

Mitochondrion0.273

Rank 2 · TkA06G039600 · TK1151

Cytoplasm0.095

Rank 3 · TkA06G039600 · TK1151

Nucleus0.047

Rank 4 · TkA06G039600 · TK1151

Plastid0.026

Rank 5 · TkA06G039600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02771Acyl-CoA_dh_N15-38 aa

PF02770Acyl-CoA_dh_M43-144 aa

PF00441Acyl-CoA_dh_1156-304 aa

PF08028Acyl-CoA_dh_2172-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G039600	`PF02771`	Acyl-CoA_dh_N	15	38	0.19	12.8
TkA06G039600	`PF02770`	Acyl-CoA_dh_M	43	144	1.3e-18	67.7
TkA06G039600	`PF00441`	Acyl-CoA_dh_1	156	304	8.4e-36	124.1
TkA06G039600	`PF08028`	Acyl-CoA_dh_2	172	282	1.4e-07	32.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWZ3`	Arabidopsis thaliana	sp\|Q8RWZ3\|IBR3_ARATH Probable acyl-CoA dehydrogenase IBR3	87.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card