TkA06G038830 | RubberDandelionOmics

Gene overview

TkA06G038830

Reference: TK1151 Chr: Chr06 Coordinates: 10446600-10452651 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2496 bp · TkA06G038830|TK1151|cDNA

AAACGTTAAAGCCACATTTTTTACGGCCTTATAAACGTTAAAAATTACAGCTTTTCAGAACATTGCTGATCTCAGGGAAAGCGAGAGTGGACGAACTGATTCCGTTTCCAAAATCATCACCATAAACAAGATCCACCTCCGAGAATCAACGCAACCCCTTTTCATCTTCAGAATTCAATACTGATATAGCAAATGGCGGACAAACCCAGCAGAGGATTGGTGTTATACGGTGACGGAGTAGCTCGATTTCTCAATCCTTC...

CDS

Download CDS FASTA

1086 bp · TkA06G038830|TK1151|CDS

ATGTCCACTCTATCTTCAAATTCCGGAGCTTTCGCTCCTTCTTCGTCTTCAAATTGCGCAACAACAACCACTGAAGACGCCGATGCACTTCGTCGGAATCGAATTCTATCGAGCAAGCTCTACTTTGATGTACCTCTATCTAAGGCTCCAATAATCTATTCGACTTCTTACGATATCTCTTTTCTCGGAATTGAAAAACTGCACCCATTTGATTCTTCAAAGTGGGGTCGCATATGCCAGTTCCTCATTGAAAATGGCGT...

Protein

Download Protein FASTA

361 aa · TkA06G038830|TK1151|PROTEIN

MSTLSSNSGAFAPSSSSNCATTTTEDADALRRNRILSSKLYFDVPLSKAPIIYSTSYDISFLGIEKLHPFDSSKWGRICQFLIENGVLNRTSIVEPREATKDDLLVVHSETYLKSLKSSLNVSIITEVPPIAVFPNCIVQNKVLYPFRKQVGGTILAAKLAKERGCAINVGGGFHHCCANQGGGFCAYADISLCIHFASIRLNISRVMIIDLDAHQGNGHEKDFSDDRRVYILDMYNPYIYPLDYEARRYIDQPVEVPSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G038830`
TK1151 ID	TkA06G038830
OH-1004 ID	LXL04_025976
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G038830

Location Chr06:10446600-10452651 (+)

Description Similar to HDA2: Histone deacetylase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g26040`	Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025976 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0000118 histone deacetylase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004407 histone deacetylase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0140297 DNA-binding transcription factor binding Molecular Function

KEGG gene cross-reference

ath:AT5G26040

hsa:79885

mcf:102133368

mmu:232232

syp:SYNPCC7002_A1628

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.458

Rank 1 · TkA06G038830 · TK1151

Nucleus0.370

Rank 2 · TkA06G038830 · TK1151

Cell membrane0.091

Rank 3 · TkA06G038830 · TK1151

Endoplasmic reticulum0.078

Rank 4 · TkA06G038830 · TK1151

Golgi apparatus0.076

Rank 5 · TkA06G038830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00850Hist_deacetyl68-349 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G038830	`PF00850`	Hist_deacetyl	68	349	6.6e-58	197.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944K3`	Arabidopsis thaliana	sp\|Q944K3\|HDA2_ARATH Histone deacetylase 2	77.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card