Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2434 bp · TkA06G031540|TK1151|cDNA
TTAAGGAAGCCTAAGCTTTTTTAGTTGCGGCCAAAACCTAACAACCCTAAACCCCCTTCTTTCAATCTCTCTGCGCCTCTCCTTCACCTCATTCCTTGATACCCTAATTTCACAGTCCGATCTTTTCTTCGGCGCAGCTCATCGCCGTCGCACCATCGTCCCGTCGTCTATCAGTTTAGAACAGTGAATGCTTGATTTGCTGTAACCATGACAGCCCAAACAAGCATTCTCTACATCACCTACTCAAACGACCTTTTAAA...
1857 bp · TkA06G031540|TK1151|CDS
ATGACAGCCCAAACAAGCATTCTCTACATCACCTACTCAAACGACCTTTTAAATGGAGAATCACTCCATGTCTCCTCAAATTGCAACCCAATCAAAGCTTCCCGCTTTGAACCAGCTGGCCATTCCTTCCATGATGCTGCACTTAAACTCCGAGGTTGTTTCATGGAAGAAACCACAGAAGACAATATCAACCAAGATTCACCCAAAGACAAAGACCAAGACTTCATGCAGTCAGCCGATTCATACAGCAGCAAAACCAA...
Protein
Download Protein FASTA618 aa · TkA06G031540|TK1151|PROTEIN
MTAQTSILYITYSNDLLNGESLHVSSNCNPIKASRFEPAGHSFHDAALKLRGCFMEETTEDNINQDSPKDKDQDFMQSADSYSSKTKKKSGDGPNKQDHYALLGLGHLRYLATDDQIRKSYRETALKHHPDKQAALLLIEETESAKQTKKDEIENHFKAIQEAYEVLMDPVKRRIFDSTDEFDDEIPSDCAPQDFFKVFGPAFLRNGRWSVVQPIPFLGDENTPLKDVDLFYDFWYGFKSWREFPHADEHDLDQAESRDE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G031540 |
|---|---|
| TK1151 ID | TkA06G031540 |
| OH-1004 ID | LXL04_026020 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 96.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 98.726Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G031540 |
|---|---|
| Location | Chr06:8578832-8583503 (+) |
| Description | Similar to Dnajc2: DnaJ homolog subfamily C member 2 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006260 DNA replication Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006450 regulation of translational fidelity Biological Process GO:0006457 protein folding Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0051083 'de novo' cotranslational protein folding Biological Process GO:1900034 regulation of cellular response to heat Biological Process GO:2000279 negative regulation of DNA biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component |
| KEGG gene cross-reference | bta:507897 hsa:27000 mcf:101865260 mmu:22791 rno:116456 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23082Myb_DNA-binding_277-89 aaPF00226DnaJ98-177 aaPF21884ZUO1-like_ZHD144-164 aaPF21884ZUO1-like_ZHD194-298 aaPF00226DnaJ309-323 aaPF23082Myb_DNA-binding_2312-319 aaPF21884ZUO1-like_ZHD331-373 aaPF23082Myb_DNA-binding_2352-352 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G031540 | PF23082 | Myb_DNA-binding_2 | 77 | 89 | 1.2e-29 | 103.0 |
| TkA06G031540 | PF00226 | DnaJ | 98 | 177 | 3.5e-15 | 56.6 |
| TkA06G031540 | PF21884 | ZUO1-like_ZHD | 144 | 164 | 7.4e-41 | 139.7 |
| TkA06G031540 | PF21884 | ZUO1-like_ZHD | 194 | 298 | 7.4e-41 | 139.7 |
| TkA06G031540 | PF00226 | DnaJ | 309 | 323 | 3.5e-15 | 56.6 |
| TkA06G031540 | PF23082 | Myb_DNA-binding_2 | 312 | 319 | 1.2e-29 | 103.0 |
| TkA06G031540 | PF21884 | ZUO1-like_ZHD | 331 | 373 | 7.4e-41 | 139.7 |
| TkA06G031540 | PF23082 | Myb_DNA-binding_2 | 352 | 352 | 1.2e-29 | 103.0 |
| TkA06G031540 | PF23082 | Myb_DNA-binding_2 | 458 | 526 | 1.2e-29 | 103.0 |
| TkA06G031540 | PF00249 | Myb_DNA-binding | 458 | 498 | 6.9e-12 | 46.0 |
| TkA06G031540 | PF13921 | Myb_DNA-bind_6 | 460 | 493 | 0.0017 | 19.2 |
| TkA06G031540 | PF00249 | Myb_DNA-binding | 571 | 614 | 6.9e-12 | 46.0 |
| TkA06G031540 | PF23082 | Myb_DNA-binding_2 | 572 | 609 | 1.2e-29 | 103.0 |
| TkA06G031540 | PF13921 | Myb_DNA-bind_6 | 572 | 614 | 0.0017 | 19.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.