TkA06G030850 | RubberDandelionOmics

Gene overview

TkA06G030850

Reference: TK1151 Chr: Chr06 Coordinates: 8377361-8383795 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4082 bp · TkA06G030850|TK1151|cDNA

CATCAATTTGCCCTGCAATAACTTAACCAAACGTGGAAAGGGGCACTTCTTGAAAACAAACAAGACAAAGTCGCATAGTCCAACTAAACAAGAAGGATTTCAAAATCTGGAAAAGAGGGGAAAAGCCTCAATTCAAATTAACGCATTAGATGCAACACACAAACACCGTGCAAATTTCACACAAGCACCGCTCTCTCGACGGTCCCCCTCCATCGGAATCACCATCGCTGACAACCTAGGAACGACCGGTGAAGCATCTT...

CDS

Download CDS FASTA

1899 bp · TkA06G030850|TK1151|CDS

ATGTCTCTTCTCAGTAGATTCTTCTATAGAAGACCTCCAGATGGCTTGCTTGAGCTTGTGGATAGAATTTATGTCTTTGATTCTTGCTTTTCAACTGAAGTTCTACCCGAGGGATTATACCAACTTTATCTACATGAAATCAGTAACGAATTACACGAAGAATTCCCTGAATCATCCTTTCTTGCATTCAATTTTCGTGAAGGTGAAAGAAGGAGCCAGTTTTCAGAAATCTTATGTGAATATGACATCACAGTCATGGA...

Protein

Download Protein FASTA

632 aa · TkA06G030850|TK1151|PROTEIN

MSLLSRFFYRRPPDGLLELVDRIYVFDSCFSTEVLPEGLYQLYLHEISNELHEEFPESSFLAFNFREGERRSQFSEILCEYDITVMDYPKQYEGCPLLPLSLVHHFLRLCDSWLALNNNQNVILLHCERGGWPILAFLLASILIYKKLQTGERKTLEIVYREAPKGLSQLLSPLNPYPSQLRYLQYISRRNLSEEWPPPERALSLDCLILRAIPNFDNKNGCRPIIRIYGRNLLSKDGLLTQMLYSTPRRGRNIRHYRQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G030850`
TK1151 ID	TkA06G030850
OH-1004 ID	LXL04_026035
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.100
Protein coverage (%)	TK1151 83.386 / OH-1004 41.859 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G030850

Location Chr06:8377361-8383795 (-)

Description Similar to FH14: Formin-like protein 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31810`	Formin-like protein 14.	No verified direct reference in this release
`At5g58160`	Formin-like protein 13.	No verified direct reference in this release
`At2g25050`	Formin-like protein 18.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0119300`	Formin-like protein 3.	No verified direct reference in this release
`Os08g0280200`	Formin-like protein 6.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026035 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009556 microsporogenesis Biological Process

GO:0051017 actin filament bundle assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0009574 preprophase band Cellular Component

GO:0015630 microtubule cytoskeleton Cellular Component

GO:0003779 actin binding Molecular Function

GO:0004721 phosphoprotein phosphatase activity Molecular Function

GO:0008017 microtubule binding Molecular Function

KEGG gene cross-reference

ath:AT1G31810

ath:AT2G25050

ath:AT3G32400

dosa:Os02g0794900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.452

Rank 1 · TkA06G030850 · TK1151

Cell membrane0.335

Rank 2 · TkA06G030850 · TK1151

Nucleus0.255

Rank 3 · TkA06G030850 · TK1151

Endoplasmic reticulum0.078

Rank 4 · TkA06G030850 · TK1151

Golgi apparatus0.075

Rank 5 · TkA06G030850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10409PTEN_C2198-337 aa

PF24059DUF7360356-377 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G030850	`PF10409`	PTEN_C2	198	337	5.1e-37	127.3
TkA06G030850	`PF24059`	DUF7360	356	377	0.082	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C6S1`	Arabidopsis thaliana	sp\|Q9C6S1\|FH14_ARATH Formin-like protein 14	69.600%	Swiss-Prot	Medium
`Q9LVN1`	Arabidopsis thaliana	sp\|Q9LVN1\|FH13_ARATH Formin-like protein 13	53.300%	Swiss-Prot	Medium
`Q9SK28`	Arabidopsis thaliana	sp\|Q9SK28\|FH18_ARATH Formin-like protein 18	51.100%	Swiss-Prot	Medium
`Q7G6K7`	Oryza sativa subsp. japonica	sp\|Q7G6K7\|FH3_ORYSJ Formin-like protein 3	57.600%	Swiss-Prot	Medium
`Q6ZCX3`	Oryza sativa subsp. japonica	sp\|Q6ZCX3\|FH6_ORYSJ Formin-like protein 6	55.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card