Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1734 bp · TkA06G028130|TK1151|cDNA
ATGTGCAGTCCGCAGAAGGTACCTCTGCTGGGTGGTCCTGAAAGTTCGTTTTTTAATTTTAACGGGTATCTCGCAGAACAATATGCAATCCGCAGCACGGAGAGACACTCCGCAGAGATGCCGACGATTAGCGATGATATCACCAAAGCTGAAAAGAAGAGCAAGAACAGAGACCACAAGCGAAAGCTCGAAGACCCAGAGCCTGAACTCGTTTCAGAATCCAAAAAGGACAAGAAAAAGAAGAAGAAAGAAAAGGGCGA...
1734 bp · TkA06G028130|TK1151|CDS
ATGTGCAGTCCGCAGAAGGTACCTCTGCTGGGTGGTCCTGAAAGTTCGTTTTTTAATTTTAACGGGTATCTCGCAGAACAATATGCAATCCGCAGCACGGAGAGACACTCCGCAGAGATGCCGACGATTAGCGATGATATCACCAAAGCTGAAAAGAAGAGCAAGAACAGAGACCACAAGCGAAAGCTCGAAGACCCAGAGCCTGAACTCGTTTCAGAATCCAAAAAGGACAAGAAAAAGAAGAAGAAAGAAAAGGGCGA...
Protein
Download Protein FASTA577 aa · TkA06G028130|TK1151|PROTEIN
MCSPQKVPLLGGPESSFFNFNGYLAEQYAIRSTERHSAEMPTISDDITKAEKKSKNRDHKRKLEDPEPELVSESKKDKKKKKKEKGDKVETPQVIANGNETLNNSDELSEKKKKKKKKQKNEEEEIKNSDVNAVEEVRETEDNVVVSGKDINDSKFKALNSFSESNLSEQLLECCKNFSKPSPIQSNSWPFLLHGRDFIGIAKTGSGKTLAFGIPAMNHILNKRKKNPTNKRTPLCLVLSPTRELAQQIFDVLSEAGKPS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G028130 |
|---|---|
| TK1151 ID | TkA06G028130 |
| OH-1004 ID | LXL04_009501 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 49.300 |
| Protein coverage (%) | TK1151 62.565 / OH-1004 55.712Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G028130 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:7617470-7620764 (+) | ||||||||||||
| Description | Similar to RH30: DEAD-box ATP-dependent RNA helicase 30 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process GO:0000380 alternative mRNA splicing, via spliceosome Biological Process GO:0006364 rRNA processing Biological Process GO:0006369 termination of RNA polymerase II transcription Biological Process GO:0009616 RNAi-mediated antiviral immune response Biological Process GO:0071042 nuclear polyadenylation-dependent mRNA catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0002151 G-quadruplex RNA binding Molecular Function GO:0003723 RNA binding Molecular Function | ||||||||||||
| KEGG gene cross-reference | ani:ANIA_05931 ath:AT1G55150 ath:AT5G63120 kla:KLLA0_F23716g These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF14617CMS145-108 aaPF31026LST2_mid49-186 aaPF15746TMEM21577-138 aaPF14617CMS1105-162 aaPF22590Cas3-like_C_2109-109 aaPF00270DEAD182-352 aaPF00271Helicase_C230-281 aaPF14617CMS1282-315 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G028130 | PF14617 | CMS1 | 45 | 108 | 0.031 | 14.4 |
| TkA06G028130 | PF31026 | LST2_mid | 49 | 186 | 5.5 | 6.3 |
| TkA06G028130 | PF15746 | TMEM215 | 77 | 138 | 1.8 | 8.7 |
| TkA06G028130 | PF14617 | CMS1 | 105 | 162 | 0.031 | 14.4 |
| TkA06G028130 | PF22590 | Cas3-like_C_2 | 109 | 109 | 9.8 | 7.2 |
| TkA06G028130 | PF00270 | DEAD | 182 | 352 | 7.2e-50 | 169.7 |
| TkA06G028130 | PF00271 | Helicase_C | 230 | 281 | 5.6e-33 | 114.2 |
| TkA06G028130 | PF14617 | CMS1 | 282 | 315 | 0.031 | 14.4 |
| TkA06G028130 | PF00271 | Helicase_C | 334 | 351 | 5.6e-33 | 114.2 |
| TkA06G028130 | PF00271 | Helicase_C | 395 | 503 | 5.6e-33 | 114.2 |
| TkA06G028130 | PF06862 | Utp25_C | 399 | 491 | 0.064 | 13.6 |
| TkA06G028130 | PF00270 | DEAD | 401 | 465 | 7.2e-50 | 169.7 |
| TkA06G028130 | PF22590 | Cas3-like_C_2 | 446 | 502 | 9.8 | 7.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.