TkA06G023100 | RubberDandelionOmics

Gene overview

TkA06G023100

Reference: TK1151 Chr: Chr06 Coordinates: 6339657-6340559 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

903 bp · TkA06G023100|TK1151|cDNA

ATGGAGTTCTTTGACGAAGAAAGCAGACCCCGATTCCTCCTTCAATCCCGATCAGTCCCAAAAGCTACCCCCCGATCCGAAACCCTTGATGATCTCCACAAACCTGCTCTCTTTGTCTCTCTTTCCCTCTCTGCCCTCTTTTTAACTCTCGCCCTTTTCTACTTCCAGTTTGATCCTCTGCAATCCATCTTCATCTGGTTCTCATTATCTCTCCTCATCGGCCCCTTTGCGCCTACATCCCTGACCGCCGGCGACATCCG...

CDS

Download CDS FASTA

903 bp · TkA06G023100|TK1151|CDS

ATGGAGTTCTTTGACGAAGAAAGCAGACCCCGATTCCTCCTTCAATCCCGATCAGTCCCAAAAGCTACCCCCCGATCCGAAACCCTTGATGATCTCCACAAACCTGCTCTCTTTGTCTCTCTTTCCCTCTCTGCCCTCTTTTTAACTCTCGCCCTTTTCTACTTCCAGTTTGATCCTCTGCAATCCATCTTCATCTGGTTCTCATTATCTCTCCTCATCGGCCCCTTTGCGCCTACATCCCTGACCGCCGGCGACATCCG...

Protein

Download Protein FASTA

300 aa · TkA06G023100|TK1151|PROTEIN

MEFFDEESRPRFLLQSRSVPKATPRSETLDDLHKPALFVSLSLSALFLTLALFYFQFDPLQSIFIWFSLSLLIGPFAPTSLTAGDIRVGLGPALQPQSPRQTPEPEPTKRSRFKTRKPDQDFISIPAALLNEAPNPKPSSKSDDNVIVVEDADWTEGDLELLKKQMVKNPVGMPGRWEAVADAFNGRHKAESVVKMAKSMGERRIGDSDSFSRFLKDRKAVDKRVDEVIENERENVSNVGGWSSTEDIALLNALKAFPKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G023100`
TK1151 ID	TkA06G023100
OH-1004 ID	LXL04_026177
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G023100

Location Chr06:6339657-6340559 (-)

Description Similar to MAMYB: Transcription factor MAMYB

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45420`	Transcription factor involved in the regulation of root hair development, possibly through auxin signaling.	Control of root hair development in Arabidopsis thaliana by an endoplasmic reticulum anchored member of the R2R3-MYB transcription factor family.2011 · DOI: 10.1111/j.1365-313x.2011.04602.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026177 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006450 regulation of translational fidelity Biological Process

GO:0006457 protein folding Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048767 root hair elongation Biological Process

GO:0051083 'de novo' cotranslational protein folding Biological Process

GO:1900034 regulation of cellular response to heat Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT5G45420

bta:507897

dre:403080

hsa:27000

xtr:394933

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.708

Rank 1 · TkA06G023100 · TK1151

Endoplasmic reticulum0.152

Rank 2 · TkA06G023100 · TK1151

Cytoplasm0.136

Rank 3 · TkA06G023100 · TK1151

Cell membrane0.083

Rank 4 · TkA06G023100 · TK1151

Plastid0.049

Rank 5 · TkA06G023100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11035SNAPC2108-118 aa

PF23082Myb_DNA-binding_2153-222 aa

PF00249Myb_DNA-binding154-188 aa

PF13921Myb_DNA-bind_6154-193 aa

PF11035SNAPC2233-290 aa

PF00249Myb_DNA-binding240-283 aa

PF23082Myb_DNA-binding_2242-287 aa

PF13921Myb_DNA-bind_6242-283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G023100	`PF11035`	SNAPC2	108	118	0.067	14.0
TkA06G023100	`PF23082`	Myb_DNA-binding_2	153	222	1.6e-39	134.5
TkA06G023100	`PF00249`	Myb_DNA-binding	154	188	1.1e-08	35.7
TkA06G023100	`PF13921`	Myb_DNA-bind_6	154	193	3e-05	24.8
TkA06G023100	`PF11035`	SNAPC2	233	290	0.067	14.0
TkA06G023100	`PF00249`	Myb_DNA-binding	240	283	1.1e-08	35.7
TkA06G023100	`PF23082`	Myb_DNA-binding_2	242	287	1.6e-39	134.5
TkA06G023100	`PF13921`	Myb_DNA-bind_6	242	283	3e-05	24.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASQ2`	Arabidopsis thaliana	sp\|Q9ASQ2\|MAMYB_ARATH Transcription factor MAMYB	46.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card