TkA06G022510 | RubberDandelionOmics

Gene overview

TkA06G022510

Reference: TK1151 Chr: Chr06 Coordinates: 6202320-6205766 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2074 bp · TkA06G022510|TK1151|cDNA

TCATGTTTAGGGTTCCAATAGAAAACAGAATTTCAAGCAACAAACCCACCACCGTCGCCTTCTGCAGTTCTGCGGCTTTCTGCCACCACAGACCGTCGCCTTCTTCTGCCACCAGCGGAGCTCCTCCTCCGTTCACAGCCGATCGCGAGCAGCAACAGCTTCTGGTCGTCCGTCGTCGCGAGCAGCAGGCAGCAGCAGCGAAGGGATTTCTTTTCTTCTTTCCGGTCGACGCAGGACGCTGCCTCTTCACGCAAATAACA...

CDS

Download CDS FASTA

1167 bp · TkA06G022510|TK1151|CDS

ATGGACTCATCATCAGCCGACTACACGAACAAGGCGAGAGCAGCACTCTTCACGATAATGGCATTTGCTGTTTTCACCGTCGCTTTATTGCTCCTCGCCTTCAGCTACTACTGCTACTTGCGCAACAAAGTTTCCAATTTCTCGAAGAACCCAAAAAACGGGATTGATTCTGTCGAAAAGGGGAATGGTGAGTCAAAAACTCAACTTCTTGTCGTAAACGGACTTCAAGTCTTCACGTTTAAGCAGCTGCTTTCTGCAAC...

Protein

Download Protein FASTA

388 aa · TkA06G022510|TK1151|PROTEIN

MDSSSADYTNKARAALFTIMAFAVFTVALLLLAFSYYCYLRNKVSNFSKNPKNGIDSVEKGNGESKTQLLVVNGLQVFTFKQLLSATGGFGKSNVIGQGGFGLVYRGVLQDGRKIAVKLMDQAGKQGEEEFRVEVEMRSMLRSPYLLALIGYCSESHHRVLVYDFMANGGLQEHLYPIRGSNAIPSNLEWEIRLRIALEAAKGLEYLHEQVSPPVIHRDFKSSNILLDKSFHAKVSDFGLAKIGSYRAGGHVSTRVLGTQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G022510`
TK1151 ID	TkA06G022510
OH-1004 ID	LXL04_026183
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G022510

Location Chr06:6202320-6205766 (-)

Description Similar to PBS1: Serine/threonine-protein kinase PBS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13160`	Protein kinase required for plant defense mechanism mediated by the disease resistance (R) protein RPS5.	The Arabidopsis PBS1 resistance gene encodes a member of a novel protein kinase subfamily.2001 · DOI: 10.1046/j.1365-313x.2001.01014.x Cleavage of Arabidopsis PBS1 by a bacterial type III effector.2003 · DOI: 10.1126/science.1085671 Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease.2007 · DOI: 10.1073/pnas.0608779104 Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector.2010 · DOI: 10.1016/j.chom.2010.03.007 Activation of a plant nucleotide binding-leucine rich repeat disease resistance protein by a modified self protein.2012 · DOI: 10.1111/j.1462-5822.2012.01779.x
`At3g20530`	May be involved in plant defense signaling.	No verified direct reference in this release
`At5g02800`	Serine/threonine-protein kinase involved in the positive regulation of brassinosteroid (BR) signaling and plant growth.	No verified direct reference in this release
`At1g20650`	May be involved in plant defense signaling.	No verified direct reference in this release
`At3g07070`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026183 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002221 pattern recognition receptor signaling pathway Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045087 innate immune response Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:1900459 positive regulation of brassinosteroid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G20650

ath:AT3G07070

ath:AT3G20530

ath:AT5G02800

ath:AT5G13160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.772

Rank 1 · TkA06G022510 · TK1151

Cytoplasm0.157

Rank 2 · TkA06G022510 · TK1151

Nucleus0.123

Rank 3 · TkA06G022510 · TK1151

Endoplasmic reticulum0.064

Rank 4 · TkA06G022510 · TK1151

Golgi apparatus0.031

Rank 5 · TkA06G022510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06024Orf785-51 aa

PF00069Pkinase92-300 aa

PF07714PK_Tyr_Ser-Thr93-366 aa

PF03109ABC196-120 aa

PF01636APH205-244 aa

PF03109ABC1207-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G022510	`PF06024`	Orf78	5	51	0.11	13.6
TkA06G022510	`PF00069`	Pkinase	92	300	1.9e-41	143.0
TkA06G022510	`PF07714`	PK_Tyr_Ser-Thr	93	366	1.3e-41	143.3
TkA06G022510	`PF03109`	ABC1	96	120	0.01	15.8
TkA06G022510	`PF01636`	APH	205	244	0.2	12.1
TkA06G022510	`PF03109`	ABC1	207	242	0.01	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FE20`	Arabidopsis thaliana	sp\|Q9FE20\|PBS1_ARATH Serine/threonine-protein kinase PBS1	49.300%	Swiss-Prot	Medium
`F4JEQ2`	Arabidopsis thaliana	sp\|F4JEQ2\|PBL23_ARATH Probable serine/threonine-protein kinase PBL23	51.900%	Swiss-Prot	High
`Q0WRY5`	Arabidopsis thaliana	sp\|Q0WRY5\|PBL7_ARATH Probable serine/threonine-protein kinase PBL7	53.100%	Swiss-Prot	High
`Q9LDZ5`	Arabidopsis thaliana	sp\|Q9LDZ5\|PBL21_ARATH Probable serine/threonine-protein kinase PBL21	48.900%	Swiss-Prot	Medium
`Q9SFT7`	Arabidopsis thaliana	sp\|Q9SFT7\|PBL26_ARATH Probable serine/threonine-protein kinase PBL26	49.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card