TkA06G021320 | RubberDandelionOmics

Gene overview

TkA06G021320

Reference: TK1151 Chr: Chr06 Coordinates: 5817197-5823857 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

1032 bp · TkA06G021320|TK1151|CDS

ATGGAGGAGAAGTACGAACCATTGAAAGAGCTCGGTTCTGGTAATTTTGGAGTGGCAAGGCTAGTTAGAGATAAGAGGACTAAAGAGTTGTTTGCTGTCAAATACATTGAAAGAGGGAAAAAGATTGATGAAAATGTTCAGAGGGAAATCATTAACCACAGGTCGTTAAGGCATCCAAACATTGTCCGGTTTAAAGAGGTGTTGTTAACTCCAACACATTTGGCTATAGTCATGGAATATGCAGCTGGTGGTGAACTTTT...

Protein

Download Protein FASTA

343 aa · TkA06G021320|TK1151|PROTEIN

MEEKYEPLKELGSGNFGVARLVRDKRTKELFAVKYIERGKKIDENVQREIINHRSLRHPNIVRFKEVLLTPTHLAIVMEYAAGGELFSKITSAGRFSEDEARFFFQQLISGVSYCHSMEICHRDLKLENTLLDGSPSPRLKICDFGYSKSGILHSQPKSTVGTPAYIAPEVLSRKEYDGKIADVWSCGVTLYVMLVGAYPFEDPEDPRNFRKTIGRIVSVQYSIPDYVRVSIDCRHLLSHIFVSNPSKRITIAEIRKHPW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G021320`
TK1151 ID	TkA06G021320
OH-1004 ID	LXL04_029850
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	87.200
Protein coverage (%)	TK1151 99.708 / OH-1004 99.707 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G021320

Location Chr06:5817197-5823857 (-)

Description Similar to SAPK3: Serine/threonine-protein kinase SAPK3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2ZAB5`	May play a role in signal transduction of hyperosmotic response.	No verified direct reference in this release
`Os10g0564500`	May play a role in signal transduction of hyperosmotic response.	No verified direct reference in this release
`UniProt: A2YNT8`	May play a role in signal transduction of hyperosmotic response (By similarity).	No verified direct reference in this release
`Os07g0622000`	May play a role in signal transduction of hyperosmotic response (Probable).	A rice orthologue of the ABA receptor, OsPYL/RCAR5, is a positive regulator of the ABA signal transduction pathway in seed germination and early seedling growth.2012 · DOI: 10.1093/jxb/err338
`Os02g0551100`	May play a role in signal transduction of hyperosmotic response (Probable).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029850 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009845 seed germination Biological Process

GO:0090351 seedling development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

dosa:Os07g0622000

dosa:Os10g0564500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.586

Rank 1 · TkA06G021320 · TK1151

Nucleus0.445

Rank 2 · TkA06G021320 · TK1151

Cell membrane0.183

Rank 3 · TkA06G021320 · TK1151

Golgi apparatus0.051

Rank 4 · TkA06G021320 · TK1151

Mitochondrion0.049

Rank 5 · TkA06G021320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase5-261 aa

PF07714PK_Tyr_Ser-Thr9-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G021320	`PF00069`	Pkinase	5	261	2.5e-72	244.2
TkA06G021320	`PF07714`	PK_Tyr_Ser-Thr	9	257	1.2e-30	107.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A2ZAB5`	Oryza sativa subsp. indica	sp\|A2ZAB5\|SAPK3_ORYSI Serine/threonine-protein kinase SAPK3	81.900%	Swiss-Prot	High
`P0C5D6`	Oryza sativa subsp. japonica	sp\|P0C5D6\|SAPK3_ORYSJ Serine/threonine-protein kinase SAPK3	81.900%	Swiss-Prot	High
`A2YNT8`	Oryza sativa subsp. indica	sp\|A2YNT8\|SAPK2_ORYSI Serine/threonine-protein kinase SAPK2	73.800%	Swiss-Prot	High
`Q0D4J7`	Oryza sativa subsp. japonica	sp\|Q0D4J7\|SAPK2_ORYSJ Serine/threonine-protein kinase SAPK2	73.800%	Swiss-Prot	High
`Q6ZI44`	Oryza sativa subsp. japonica	sp\|Q6ZI44\|SAPK6_ORYSJ Serine/threonine-protein kinase SAPK6	70.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card