RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G021030
Reference: TK1151 Chr: Chr06 Coordinates: 5736217-5737960 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1146 bp · TkA06G021030|TK1151|cDNA

CTCCATGTTAAACATTGTAATGACAATATTTCATGTGGTTTTCTTTGGATTCATATCATTATAATTGCGGGCATATGCTACGGGAACACAGAAAACTTAATCCAGCCTAAAAGCTTTGCTCCTTATGGTGTCAAAGGCATTATTGATGGAGCAGCCATTGTTTATTTTAGCTACATCGGTTATGATTCAGTCTCAACAATGGCTGAAGAGATTCAGAACCCATCAAAGAGCCTTCCATTGGGCATAATTGGTTCAGTCCT...

CDS

Download CDS FASTA

1146 bp · TkA06G021030|TK1151|CDS

CTCCATGTTAAACATTGTAATGACAATATTTCATGTGGTTTTCTTTGGATTCATATCATTATAATTGCGGGCATATGCTACGGGAACACAGAAAACTTAATCCAGCCTAAAAGCTTTGCTCCTTATGGTGTCAAAGGCATTATTGATGGAGCAGCCATTGTTTATTTTAGCTACATCGGTTATGATTCAGTCTCAACAATGGCTGAAGAGATTCAGAACCCATCAAAGAGCCTTCCATTGGGCATAATTGGTTCAGTCCT...

Protein

Download Protein FASTA

381 aa · TkA06G021030|TK1151|PROTEIN

LHVKHCNDNISCGFLWIHIIIIAGICYGNTENLIQPKSFAPYGVKGIIDGAAIVYFSYIGYDSVSTMAEEIQNPSKSLPLGIIGSVLIVSVLYCLMALSLCLMVPYNKISSSASFSIAFQNIGWKWASNIVGAGATLGIVASLLVAMLGQARYLCVIGRARLVPSWFAKVHPTTGTPQNATIFLGFCQASIALFTELNIVLEMISIGTLMVFYLVANALIYHRYAINTSNPPIYTLVFLLLLSSASIGFSISWNLNHQPR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G021030
TK1151 IDTkA06G021030
OH-1004 IDLXL04_026216
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)99.200
Protein coverage (%)TK1151 95.013 / OH-1004 61.046
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G021030
LocationChr06:5736217-5737960 (-)
DescriptionSimilar to CAT6: Cationic amino acid transporter 6, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g04770 Permease involved in the transport of the cationic neutral or acidic amino acids.
Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278
At3g10600 Permease involved in the transport of the cationic amino acids. No verified direct reference in this release
At4g21120 High-affinity permease involved in the transport of the cationic amino acids (e.g. arginine, lysine, histidine, citrulline, valine, and glutamate). No verified direct reference in this release
At1g17120 Permease involved in the transport of the cationic neutral or acidic amino acids.
Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278
At2g34960 High-affinity permease involved in the transport of the cationic amino acids (e.g. arginine, and, to a lower extent, citrulline and glutamate).
Molecular and functional characterization of a family of amino acid transporters from Arabidopsis.2004 · DOI: 10.1104/pp.104.045278

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_026216 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006865 amino acid transport Biological Process
GO:0009624 response to nematode Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0016020 membrane Cellular Component
GO:0031969 chloroplast membrane Cellular Component
GO:0015171 amino acid transmembrane transporter activity Molecular Function
KEGG gene cross-reference
ath:AT1G17120
ath:AT2G34960
ath:AT3G10600
ath:AT4G21120
ath:AT5G04770
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.425
Rank 1 · TkA06G021030 · TK1151
Cell membrane0.327
Rank 2 · TkA06G021030 · TK1151
Cytoplasm0.152
Rank 3 · TkA06G021030 · TK1151
Endoplasmic reticulum0.131
Rank 4 · TkA06G021030 · TK1151
Golgi apparatus0.100
Rank 5 · TkA06G021030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13520AA_permease_214-251 aa
PF00324AA_permease14-230 aa
PF13906AA_permease_C16-28 aa
PF13906AA_permease_C53-61 aa
PF09842DUF206984-95 aa
PF05297Herpes_LMP1171-339 aa
PF09842DUF2069186-223 aa
PF13906AA_permease_C210-227 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G021030PF13520AA_permease_2142516.5e-30105.1
TkA06G021030PF00324AA_permease142302.4e-2073.4
TkA06G021030PF13906AA_permease_C16281.8e-1247.9
TkA06G021030PF13906AA_permease_C53611.8e-1247.9
TkA06G021030PF09842DUF206984950.004717.7
TkA06G021030PF05297Herpes_LMP11713397.96.3
TkA06G021030PF09842DUF20691862230.004717.7
TkA06G021030PF13906AA_permease_C2102271.8e-1247.9
TkA06G021030PF09842DUF20692452700.004717.7
TkA06G021030PF00324AA_permease2653132.4e-2073.4
TkA06G021030PF13906AA_permease_C2662791.8e-1247.9
TkA06G021030PF13906AA_permease_C2943431.8e-1247.9
TkA06G021030PF09842DUF20692943490.004717.7
TkA06G021030PF13520AA_permease_22973136.5e-30105.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LZ20Arabidopsis thalianasp|Q9LZ20|CAAT6_ARATH Cationic amino acid transporter 6, chloroplastic49.300%Swiss-ProtMedium
Q9SQZ0Arabidopsis thalianasp|Q9SQZ0|CAAT7_ARATH Cationic amino acid transporter 7, chloroplastic48.400%Swiss-ProtMedium
Q84MA5Arabidopsis thalianasp|Q84MA5|CAAT1_ARATH Cationic amino acid transporter 138.500%Swiss-ProtMedium
Q9SHH0Arabidopsis thalianasp|Q9SHH0|CAAT8_ARATH Cationic amino acid transporter 8, vacuolar39.800%Swiss-ProtMedium
O64759Arabidopsis thalianasp|O64759|CAAT5_ARATH Cationic amino acid transporter 539.100%Swiss-ProtMedium

JBrowse

View in Genome Browser