TkA06G019520 | RubberDandelionOmics

Gene overview

TkA06G019520

Reference: TK1151 Chr: Chr06 Coordinates: 5341380-5343425 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1629 bp · TkA06G019520|TK1151|cDNA

ATAAGGATTATGATAGCAGCTGATTCCCGATACTACCAATAGTTTGAAAGATCAGTCAAAAGAGATATAAAGAATAGAATATATATTTTAAAGAAATACTTGTATGTATATAGTTCTATAATAAAACTCGTGTGATATTAAAGCTGTCTACACAAAGCCATTGATGTGATCTAAGAGAGTTTCATTCGGTTCTCTAATTAGCAAAAGTGCAACTTGATCCGTATCCTATCGGTCTATTTAGACATCACCACAAGTTTCTT...

CDS

Download CDS FASTA

1134 bp · TkA06G019520|TK1151|CDS

ATGGATAGTAAGAACAATGGCAAATGGTACCCCGTTTTGGTTATGGTTGCCGTTCATTTTGTTTTCGCTACTATTAATGTACTCCTCAAAAAGGTTATAGTCGATGGACTCAACCATCTCGTCTTTATTACTTACCGCCTGACTGTCGCCACCATCTTTTTGGCCCCCGTAGCCTTCTTTTTCGAAAGGAAGAGCCAACCGAAGCTCACATACAGCATATTGTTCTTCCTTTTCGTTAATGCCATTCTTGGGGCATCGCT...

Protein

Download Protein FASTA

377 aa · TkA06G019520|TK1151|PROTEIN

MDSKNNGKWYPVLVMVAVHFVFATINVLLKKVIVDGLNHLVFITYRLTVATIFLAPVAFFFERKSQPKLTYSILFFLFVNAILGASLTQYLFLLGLQYTSATFTCAFLNMVPVITFIISLPFGLESVKIKSNAGKAKVIGTIVCLGGGMLLTLYKGMPLFNHHSHLQLETTTAAASIHTQSITRSSSLLATKKARWASGSLSLIAGTVLWSSWFLVQSNIGKRYPFQYSSTAIMMFFGAIQSFALSLSVDRDLSSWILKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G019520`
TK1151 ID	TkA06G019520
OH-1004 ID	LXL04_026227
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 97.416 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G019520

Location Chr06:5341380-5343425 (+)

Description Similar to At3g30340: WAT1-related protein At3g30340

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g30340`	WAT1-related protein At3g30340.	No verified direct reference in this release
`At4g01440`	WAT1-related protein At4g01440.	No verified direct reference in this release
`At4g01450`	WAT1-related protein At4g01450.	No verified direct reference in this release
`At1g01070`	WAT1-related protein At1g01070.	No verified direct reference in this release
`At4g01430`	WAT1-related protein At4g01430.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026227 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0048316 seed development Biological Process

GO:1901349 glucosinolate transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0015186 L-glutamine transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0141165 glucosinolate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G01070

ath:AT3G30340

ath:AT4G01430

ath:AT4G01440

ath:AT4G01450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.469

Rank 1 · TkA06G019520 · TK1151

Lysosome / Vacuole0.230

Rank 2 · TkA06G019520 · TK1151

Endoplasmic reticulum0.176

Rank 3 · TkA06G019520 · TK1151

Golgi apparatus0.071

Rank 4 · TkA06G019520 · TK1151

Cytoplasm0.067

Rank 5 · TkA06G019520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892EamA12-150 aa

PF16080Phage_holin_2_380-107 aa

PF00892EamA198-336 aa

PF16080Phage_holin_2_3322-343 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G019520	`PF00892`	EamA	12	150	1.4e-26	94.1
TkA06G019520	`PF16080`	Phage_holin_2_3	80	107	0.27	12.0
TkA06G019520	`PF00892`	EamA	198	336	1.4e-26	94.1
TkA06G019520	`PF16080`	Phage_holin_2_3	322	343	0.27	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LI65`	Arabidopsis thaliana	sp\|Q9LI65\|WTR24_ARATH WAT1-related protein At3g30340	48.600%	Swiss-Prot	Medium
`Q9M130`	Arabidopsis thaliana	sp\|Q9M130\|WTR29_ARATH WAT1-related protein At4g01440	46.700%	Swiss-Prot	Medium
`Q9M129`	Arabidopsis thaliana	sp\|Q9M129\|WTR30_ARATH WAT1-related protein At4g01450	44.600%	Swiss-Prot	Medium
`Q5XEZ0`	Arabidopsis thaliana	sp\|Q5XEZ0\|WTR1_ARATH WAT1-related protein At1g01070	41.800%	Swiss-Prot	Medium
`Q9M131`	Arabidopsis thaliana	sp\|Q9M131\|WTR28_ARATH WAT1-related protein At4g01430	42.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card