TkA06G018010 | RubberDandelionOmics

Gene overview

TkA06G018010

Reference: TK1151 Chr: Chr06 Coordinates: 4927800-4930886 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

905 bp · TkA06G018010|TK1151|cDNA

TTTAGAATGGCCCTTTTAGAAGCACAATTTCTTCCCCAATTTAGTTAATAACATCAGATTACAAATTCTTCCCCAATTTTGTACATACTGCACAAATCAGCGACCTAAGATCTAACTTTAGGCGCAAACAAACCTATCGATCTGTAGACTGTATAGTGCTATTTTGAATCCAAAACAGAGATGGAATCCTCGCAGGCCACCGGCGCAGCAGCCTCCGGCGGTAACGGTACGCTTAATTCCCAAAACAACGACGCTTCACC...

CDS

Download CDS FASTA

591 bp · TkA06G018010|TK1151|CDS

ATGGAATCCTCGCAGGCCACCGGCGCAGCAGCCTCCGGCGGTAACGGTACGCTTAATTCCCAAAACAACGACGCTTCACCTGCTGAATCAACAGTCTCGGCAACTACTTCGTCGTCGGACGATCCCAAGCAAAACCTAAACCAAGTCATCAATTCAATTCAAAAAACCCTAGGAACCATTCATCAGCTGTACCTCACTGTCTCCTCCTTCAACGTCTCATCCCAACTCCCGCTCCTCCAACGCCTAAATACACTTGTTAT...

Protein

Download Protein FASTA

196 aa · TkA06G018010|TK1151|PROTEIN

MESSQATGAAASGGNGTLNSQNNDASPAESTVSATTSSSDDPKQNLNQVINSIQKTLGTIHQLYLTVSSFNVSSQLPLLQRLNTLVMEMDNMAKLSEKCNIQVPMEVLNLIDDGKNPDEFTRDVLNSCIAKNQITKGKTDAFKGLRRHLLEELEQAFPDEVEDYREIRASSAAESMRLAQAQNMLPNGDVKIKPEM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G018010`
TK1151 ID	TkA06G018010
OH-1004 ID	LXL04_026251
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G018010

Location Chr06:4927800-4930886 (+)

Description Similar to MED10B: Mediator of RNA polymerase II transcription subunit 10b

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26665`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	No verified direct reference in this release
`At5g41910`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026251 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0051123 RNA polymerase II preinitiation complex assembly Biological Process

GO:0060261 positive regulation of transcription initiation by RNA polymerase II Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

aag:5564532

ath:AT1G26665

ath:AT5G41910

mmu:28077

pon:100190825

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.895

Rank 1 · TkA06G018010 · TK1151

Cytoplasm0.239

Rank 2 · TkA06G018010 · TK1151

Mitochondrion0.026

Rank 3 · TkA06G018010 · TK1151

Cell membrane0.023

Rank 4 · TkA06G018010 · TK1151

Golgi apparatus0.014

Rank 5 · TkA06G018010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29868Anionic_AP239-59 aa

PF09748Med1052-165 aa

PF08385DHC_N178-157 aa

PF19753DUF624086-141 aa

PF17102Stealth_CR3145-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G018010	`PF29868`	Anionic_AP2	39	59	0.027	15.2
TkA06G018010	`PF09748`	Med10	52	165	2.2e-35	121.9
TkA06G018010	`PF08385`	DHC_N1	78	157	0.049	13.0
TkA06G018010	`PF19753`	DUF6240	86	141	0.011	15.8
TkA06G018010	`PF17102`	Stealth_CR3	145	162	0.11	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HPA7`	Arabidopsis thaliana	sp\|F4HPA7\|MD10B_ARATH Mediator of RNA polymerase II transcription subunit 10b	69.400%	Swiss-Prot	High
`Q9FHZ2`	Arabidopsis thaliana	sp\|Q9FHZ2\|MD10A_ARATH Mediator of RNA polymerase II transcription subunit 10a	75.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card