TkA06G017600 | RubberDandelionOmics

Gene overview

TkA06G017600

Reference: TK1151 Chr: Chr06 Coordinates: 4795036-4798641 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2645 bp · TkA06G017600|TK1151|cDNA

ATGAAAAGAGGATTGGGCCTTGGGGTGGGGTTTGGGCCTGTTAAAAGGATAATTGCCCTTCTACAGGACACACAAAGATGGCTGATGATGGGAGTGTGTGTTGCTTTTGGTGTGTGAGAGAGAAAATAGAGATGCAATCGTCATCGTCATCGCCATTTATCATCTTTAACGGTGACAATGCATAATTAGATTCGAGTATTGTGCAGTGGATACAACCGAAACAACACTCTGGGGGCAAGAATTAAAGCACTTTAAATTAG...

CDS

Download CDS FASTA

1686 bp · TkA06G017600|TK1151|CDS

ATGTTGGCCTCACATCAGAAACATCATGTATTAAGAGCACTCCGGCGGAGTCACACTTCCTCACCTTCATCTTCGAATTCGTCCTCTCCGACATCGTCGTCGTCGTCATCGTGGATTCATTTGCGATCAGTTCTATCAGTCGTTGCTTCCTCGTCATCATCCTCACCAATTTCTACTACTAGGGGTCACCTTCAATCCCCATGGTCCAAAAGGAGAAGAAAACATGCTCTTCAGCCAAAACAATGGAAAGCTTTATTCGA...

Protein

Download Protein FASTA

561 aa · TkA06G017600|TK1151|PROTEIN

MLASHQKHHVLRALRRSHTSSPSSSNSSSPTSSSSSSWIHLRSVLSVVASSSSSSPISTTRGHLQSPWSKRRRKHALQPKQWKALFDEDGRLCDGGVKFLKKVRSGGIHPSLRLEVWPFLLGVYDLKSSKEERDAVKTKNRKEYKKLRKQCKLTYIFRHNSTNELFADVSNQPDPANEETHDDVINTKKETLDDVSDTQEETRKDNNDSSSQEEEITDDDVSSNNNNKKDEDSKVGSGSGVSNKIDTCESSDSDTSSSEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G017600`
TK1151 ID	TkA06G017600
OH-1004 ID	LXL04_026256
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.200
Protein coverage (%)	TK1151 89.661 / OH-1004 82.862 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G017600

Location Chr06:4795036-4798641 (-)

Description Similar to RABGAP22: Rab GTPase-activating protein 22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53570`	Involved in defense response against fungal and bacterial pathogens.	RabGAP22 is required for defense to the vascular pathogen Verticillium longisporum and contributes to stomata immunity.2014 · DOI: 10.1371/journal.pone.0088187

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026256 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005096 GTPase activator activity Molecular Function

KEGG gene cross-reference

ath:AT5G53570

spo:2543609

yli:2907695

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.468

Rank 1 · TkA06G017600 · TK1151

Nucleus0.342

Rank 2 · TkA06G017600 · TK1151

Cell membrane0.179

Rank 3 · TkA06G017600 · TK1151

Endoplasmic reticulum0.076

Rank 4 · TkA06G017600 · TK1151

Golgi apparatus0.075

Rank 5 · TkA06G017600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00566RabGAP-TBC111-150 aa

PF16525MHB154-194 aa

PF00566RabGAP-TBC187-233 aa

PF00566RabGAP-TBC358-479 aa

PF23436RabGap-TBC_2358-477 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G017600	`PF00566`	RabGAP-TBC	111	150	6.7e-30	105.1
TkA06G017600	`PF16525`	MHB	154	194	0.15	13.0
TkA06G017600	`PF00566`	RabGAP-TBC	187	233	6.7e-30	105.1
TkA06G017600	`PF00566`	RabGAP-TBC	358	479	6.7e-30	105.1
TkA06G017600	`PF23436`	RabGap-TBC_2	358	477	1.1e-13	52.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BY9`	Arabidopsis thaliana	sp\|Q94BY9\|GAP22_ARATH Rab GTPase-activating protein 22	58.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card