TkA06G011580 | RubberDandelionOmics

Gene overview

TkA06G011580

Reference: TK1151 Chr: Chr06 Coordinates: 3036814-3038264 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1101 bp · TkA06G011580|TK1151|cDNA

TTTGAAGACCCTCACAAACAAACAGTCCGCTGGAATCAAGGAAGAAAATGGCGTCAAAAAGGATTGATTGGTGTTACGGGGGGAAACAAAGGCGTTGGTTTAGAAATTTGCAAGCAGTTGGCTAATGAAGTTGTGGTGGTGTTGACCGCAAGAGACGATAAGAGGGGCACCGACGCCGTCGCCCAATTGCACTCCTCCGTGTTTCCCGACGTCATATTTCATCAACTTGATGTCACTAATCTCGCCAGTATTGCTTCCTT...

CDS

Download CDS FASTA

546 bp · TkA06G011580|TK1151|CDS

TTTGAAGACCCTCACAAACAAACAGTCCGCTGGAATCAAGGAAGAAAATGGCGTCAAAAAGGATTGATTGGTGTTACGGGGGGAAACAAAGGCGTTGGTTTAGAAATTTGCAAGCAGTTGGCTAATGAAGTTGTGGTGGTGTTGACCGCAAGAGACGATAAGAGGGGCACCGACGCCGTCGCCCAATTGCACTCCTCCGTGTTTCCCGACGTCATATTTCATCAACTTGATGTCACTAATCTCGCCAGTATTGCTTCCTT...

Protein

Download Protein FASTA

181 aa · TkA06G011580|TK1151|PROTEIN

FEDPHKQTVRWNQGRKWRQKGLIGVTGGNKGVGLEICKQLANEVVVVLTARDDKRGTDAVAQLHSSVFPDVIFHQLDVTNLASIASLANFIEARFGKLDILVNNAGIASTIVDEESFWSLNLPSEVIGVEAMQSNQVVAQTFEGAQNCLETNYYGAKHVTQALLTLLLKSTSPRIVNISSN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G011580`
TK1151 ID	TkA06G011580
OH-1004 ID	LXL04_026468
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.600
Protein coverage (%)	TK1151 91.713 / OH-1004 41.412 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G011580

Location Chr06:3036814-3038264 (-)

Description Similar to SALR: Salutaridine reductase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61220`	Aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026468 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009820 alkaloid metabolic process Biological Process

GO:0016104 triterpenoid biosynthetic process Biological Process

GO:0016135 saponin biosynthetic process Biological Process

GO:0097295 morphine biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

KEGG gene cross-reference

ag:ABC47654

ath:AT3G61220

cann:107839158

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.552

Rank 1 · TkA06G011580 · TK1151

Nucleus0.242

Rank 2 · TkA06G011580 · TK1151

Peroxisome0.134

Rank 3 · TkA06G011580 · TK1151

Mitochondrion0.098

Rank 4 · TkA06G011580 · TK1151

Endoplasmic reticulum0.074

Rank 5 · TkA06G011580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short24-181 aa

PF08659KR25-109 aa

PF01370Epimerase25-133 aa

PF13561adh_short_C229-110 aa

PF13561adh_short_C2126-180 aa

PF08659KR132-163 aa

PF01370Epimerase137-180 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G011580	`PF00106`	adh_short	24	181	6.1e-24	85.3
TkA06G011580	`PF08659`	KR	25	109	4.4e-05	24.2
TkA06G011580	`PF01370`	Epimerase	25	133	0.0026	17.9
TkA06G011580	`PF13561`	adh_short_C2	29	110	2.6e-16	60.6
TkA06G011580	`PF13561`	adh_short_C2	126	180	2.6e-16	60.6
TkA06G011580	`PF08659`	KR	132	163	4.4e-05	24.2
TkA06G011580	`PF01370`	Epimerase	137	180	0.0026	17.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2E2`	Arabidopsis thaliana	sp\|Q9M2E2\|SDR1_ARATH (+)-neomenthol dehydrogenase	46.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card