Gene Card
Gene overview
cDNA / CDS / Protein Sequences
626 bp · TkA06G010470|TK1151|cDNA
TAAAAGTGTACAATTAAAAAACCCTACACACCAAAAAATCGGCCGCTACATCCATTGCTTCTTCCTCGCTTCTTCTTCACGACCTCCATCGACCTCCAATCCTCCATAGCTGCTTCACGACCGCCATCTGTTCCGGTGTAGGGGCAACTCATAAACCCCAAACCCTTCTCTAGTTTCTATCAGGCCGCACGTCCTCGTAGTCATCCGTTTTCCCACCTCTTCCCGCCGCCGGAAAAGCATCAACACCACCGAAGTTCTGC...
1359 bp · TkA06G010470|TK1151|CDS
ATGAAGGTCAAGGTTATATCTCGCTCTGCAGATGAATTTACACGCGAGCGGAGTAACGATCTTCAGAGGGTTTCTCGGAACTACGACCCAAACCTGCGTCCTCAAGAGAAGGCGGTGGAGTATGTTAGAGCCCTTAATGCAGCTAAATTGGATAAGGTATTTGCAAGACCATTTATTGGAGCCATGGATGGGCATATAGACGCCATTTCATGTATGGCAAAAAACCCTAGTCACTTGAAAGGTTTATTTTCTGGTTCCAT...
Protein
Download Protein FASTA452 aa · TkA06G010470|TK1151|PROTEIN
MKVKVISRSADEFTRERSNDLQRVSRNYDPNLRPQEKAVEYVRALNAAKLDKVFARPFIGAMDGHIDAISCMAKNPSHLKGLFSGSMDGDIRLWDIASRKTICQYSGHQGAVRGLTVSTDGRILVSCGTDCTVRLWKVPLSSGIESSDSSDTSDKSIASYVWKNAFWGVDHQWEGNIFATAGAQVDIWDHNRSQPITSFEWGNDTVISVRFNPGEPNILATSGSDRSITIYDLRTSSPARKLIMRTKTNSIAWNPMEPMN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G010470 |
|---|---|
| TK1151 ID | TkA06G010470 |
| OH-1004 ID | LXL04_026442 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G010470 |
|---|---|
| Location | Chr06:2692877-2697759 (+) |
| Description | Similar to DCAF13: DDB1- and CUL4-associated factor 13 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0007056 spindle assembly involved in female meiosis Biological Process GO:0016567 protein ubiquitination Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0040029 epigenetic regulation of gene expression Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0044725 epigenetic programming in the zygotic pronuclei Biological Process GO:0045995 regulation of embryonic development Biological Process GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component |
| KEGG gene cross-reference | gga:420263 hsa:25879 mmu:223499 xtr:407967 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25175Beta-prop_WDR559-138 aaPF24807WD40_CDC20-Fz59-143 aaPF24805EIF3I59-103 aaPF23869Beta-prop_WDR75_1st59-97 aaPF23381Beta-prop_IFT122_1st60-139 aaPF00400WD4060-95 aaPF23215WD_LRWD160-100 aaPF24814WD40_Prp1961-310 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G010470 | PF25175 | Beta-prop_WDR5 | 59 | 138 | 4e-38 | 132.1 |
| TkA06G010470 | PF24807 | WD40_CDC20-Fz | 59 | 143 | 4.5e-32 | 112.2 |
| TkA06G010470 | PF24805 | EIF3I | 59 | 103 | 7.3e-22 | 78.6 |
| TkA06G010470 | PF23869 | Beta-prop_WDR75_1st | 59 | 97 | 2.1e-10 | 41.1 |
| TkA06G010470 | PF23381 | Beta-prop_IFT122_1st | 60 | 139 | 1.6e-38 | 133.4 |
| TkA06G010470 | PF00400 | WD40 | 60 | 95 | 6.7e-36 | 121.9 |
| TkA06G010470 | PF23215 | WD_LRWD1 | 60 | 100 | 0.067 | 12.9 |
| TkA06G010470 | PF24814 | WD40_Prp19 | 61 | 310 | 2.5e-31 | 109.5 |
| TkA06G010470 | PF24105 | Beta-prop_CAF1B_HIR1 | 61 | 138 | 1.5e-18 | 67.7 |
| TkA06G010470 | PF25174 | Beta-prop_THOC3 | 62 | 142 | 9.6e-43 | 146.9 |
| TkA06G010470 | PF25173 | Beta-prop_WDR3_1st | 62 | 141 | 4.3e-36 | 125.1 |
| TkA06G010470 | PF24796 | WDR55 | 62 | 138 | 8.1e-24 | 84.9 |
| TkA06G010470 | PF20426 | NBCH_WD40 | 62 | 100 | 1.5e-09 | 38.0 |
| TkA06G010470 | PF23414 | Beta-prop_EML_2 | 63 | 149 | 8.2e-26 | 91.7 |
| TkA06G010470 | PF25171 | Beta-prop_WDR36-Utp21_1st | 64 | 136 | 1.8e-13 | 51.3 |
| TkA06G010470 | PF23775 | Beta-prop_RIG_2nd | 64 | 119 | 1.1e-09 | 38.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.