TkA06G006660 | RubberDandelionOmics

Gene overview

TkA06G006660

Reference: TK1151 Chr: Chr06 Coordinates: 1717937-1720750 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1990 bp · TkA06G006660|TK1151|cDNA

ATAATACCCAAAGGCGTGGTTCAGGTCCTAGAGAGAGAAAGTAACAGCTCTATTTTCCATGGCGATTTAGTCAAGAATTTCTTAGATTTTGGGTTCTCTGTTAGCTGTAAACCGCTATTCCTTTGGTCAAATCGTTCCCATAGCAACAAGAGTTGCAATCACGACCTATTTCATCGTTTTTCATCTCCTTCTATATATATAATAATATCTCACTGAAAGGAAAACGAAGAGGAAGCAAACATGATGCAGATGGAGAGGAG...

CDS

Download CDS FASTA

1353 bp · TkA06G006660|TK1151|CDS

ATGATGCAGATGGAGAGGAGGCCTTATTTGGATGAGTTTGAAAAACTGCTCGTGAGAATGAACACTCCAAGGGTCATGATCGACAATGCCGGCTGTGTAAACGCAACCCTCGTCATGATTGATAGTGCCAGAAAAGATGGAATACTTCTAGAGGCTGTTCAAGTGCTTACGGATTTGAATCTTCTAATTAAAAAGGGGTATGTCTCATCAGATGGAAGGTGGAACATGGATGTCTTTCATGTAACCGATTTGAGCGGCAA...

Protein

Download Protein FASTA

450 aa · TkA06G006660|TK1151|PROTEIN

MMQMERRPYLDEFEKLLVRMNTPRVMIDNAGCVNATLVMIDSARKDGILLEAVQVLTDLNLLIKKGYVSSDGRWNMDVFHVTDLSGNKLTDNNIINCIQHSLGTIRNTRSKSIDGMTAIELTGTDRVGLLSEVFAVLSDLKCDVAESKVWTHNGRIASLIYLKDCDSGCSIDDSQKIGKIEARLRNVLKGDNDIRSAKTSVSMAITHTERRLHQMMFADRDYERSAIIKTSGEYSPLVSVQNCLEKEYSVVNIQCKDRPK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G006660`
TK1151 ID	TkA06G006660
OH-1004 ID	LXL04_026524
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G006660

Location Chr06:1717937-1720750 (-)

Description Similar to ACR8: ACT domain-containing protein ACR8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12420`	May bind amino acids.	Molecular characterization of a novel gene family encoding ACT domain repeat proteins in Arabidopsis.2002 · DOI: 10.1104/pp.007484
`At4g22780`	May bind amino acids.	No verified direct reference in this release
`At1g69040`	May bind amino acids.	No verified direct reference in this release
`At1g76990`	May bind amino acids.	Molecular characterization of a novel gene family encoding ACT domain repeat proteins in Arabidopsis.2002 · DOI: 10.1104/pp.007484
`At3g01990`	May bind amino acids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026524 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G12420

ath:AT1G69040

ath:AT1G76990

ath:AT4G22780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.481

Rank 1 · TkA06G006660 · TK1151

Nucleus0.408

Rank 2 · TkA06G006660 · TK1151

Cell membrane0.139

Rank 3 · TkA06G006660 · TK1151

Lysosome / Vacuole0.069

Rank 4 · TkA06G006660 · TK1151

Endoplasmic reticulum0.046

Rank 5 · TkA06G006660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24931ACT_ACR9_3rd25-100 aa

PF26956ACT_ACR_D132-107 aa

PF24914ACR10_N36-89 aa

PF22754bHLH-TF_ACT-like_plant37-69 aa

PF13291ACT_442-70 aa

PF01842ACT47-87 aa

PF26956ACT_ACR_D1114-149 aa

PF24931ACT_ACR9_3rd116-187 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G006660	`PF24931`	ACT_ACR9_3rd	25	100	3.2e-21	75.9
TkA06G006660	`PF26956`	ACT_ACR_D1	32	107	2.1e-47	159.6
TkA06G006660	`PF24914`	ACR10_N	36	89	1e-08	35.2
TkA06G006660	`PF22754`	bHLH-TF_ACT-like_plant	37	69	2.6e-13	50.6
TkA06G006660	`PF13291`	ACT_4	42	70	5.1e-11	43.8
TkA06G006660	`PF01842`	ACT	47	87	6.5e-29	100.0
TkA06G006660	`PF26956`	ACT_ACR_D1	114	149	2.1e-47	159.6
TkA06G006660	`PF24931`	ACT_ACR9_3rd	116	187	3.2e-21	75.9
TkA06G006660	`PF22754`	bHLH-TF_ACT-like_plant	117	164	2.6e-13	50.6
TkA06G006660	`PF13291`	ACT_4	117	152	5.1e-11	43.8
TkA06G006660	`PF01842`	ACT	118	161	6.5e-29	100.0
TkA06G006660	`PF24926`	ACT_ACR9_C	118	152	5.7e-06	26.9
TkA06G006660	`PF24914`	ACR10_N	119	140	1e-08	35.2
TkA06G006660	`PF13740`	ACT_6	119	185	1.1e-08	35.5
TkA06G006660	`PF22629`	ACT_AHAS_ss	120	162	0.00077	20.3
TkA06G006660	`PF24931`	ACT_ACR9_3rd	238	320	3.2e-21	75.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNA5`	Arabidopsis thaliana	sp\|Q9LNA5\|ACR8_ARATH ACT domain-containing protein ACR8	64.800%	Swiss-Prot	High
`Q8LJW1`	Arabidopsis thaliana	sp\|Q8LJW1\|ACR7_ARATH ACT domain-containing protein ACR7	60.600%	Swiss-Prot	High
`Q8LJW3`	Arabidopsis thaliana	sp\|Q8LJW3\|ACR4_ARATH ACT domain-containing protein ACR4	52.700%	Swiss-Prot	High
`O49285`	Arabidopsis thaliana	sp\|O49285\|ACR3_ARATH ACT domain-containing protein ACR3	47.300%	Swiss-Prot	Medium
`Q9SGA0`	Arabidopsis thaliana	sp\|Q9SGA0\|ACR6_ARATH ACT domain-containing protein ACR6	52.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card