Gene Card
Gene overview
cDNA / CDS / Protein Sequences
828 bp · TkA06G004570|TK1151|cDNA
ATGGCTTCTCCCTCGGATCTTGAAAACGCAATCACCTCAACCGCCCTTCCTTACTCCTACTCCCCGTTGCCGGATGGTGAGCAAGAACAACCTGCCGGAAATGACTCCACCATCCGGCCATGCAGAAAGACAGCTTCTTTTCTGTTTCTGTTGTCTGTGCTGTTGACCGTTGGCTTTCTAGTGTCCCTGTTCACCGAAGACGGGACAGTACTTCCAAAAACCATGAACAGCCGGGCTGTGCCAGCTTCTGCGAAGCTCCG...
828 bp · TkA06G004570|TK1151|CDS
ATGGCTTCTCCCTCGGATCTTGAAAACGCAATCACCTCAACCGCCCTTCCTTACTCCTACTCCCCGTTGCCGGATGGTGAGCAAGAACAACCTGCCGGAAATGACTCCACCATCCGGCCATGCAGAAAGACAGCTTCTTTTCTGTTTCTGTTGTCTGTGCTGTTGACCGTTGGCTTTCTAGTGTCCCTGTTCACCGAAGACGGGACAGTACTTCCAAAAACCATGAACAGCCGGGCTGTGCCAGCTTCTGCGAAGCTCCG...
Protein
Download Protein FASTA275 aa · TkA06G004570|TK1151|PROTEIN
MASPSDLENAITSTALPYSYSPLPDGEQEQPAGNDSTIRPCRKTASFLFLLSVLLTVGFLVSLFTEDGTVLPKTMNSRAVPASAKLRFSTMDGTTCSINTNPMLPYGARSFGATPSATILPDGQLVVLYTGSTKESVQVQNLAYPADPSDPLLINWVKYPGNPVLVPPPGIDNKDFRDPTTAWKTPEGKWRITIGSKINKTERENGLDTSVDGPEVKHVVKASMDDVRNDYYAIGTYDANKGKWTPDNPTLDVGIGLRYD...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G004570 |
|---|---|
| TK1151 ID | TkA06G004570 |
| OH-1004 ID | LXL04_026565 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 69.600 |
| Protein coverage (%) | TK1151 92.000 / OH-1004 69.851Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G004570 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:1122458-1124346 (+) | |||||||||
| Description | Similar to INV*DC4: Beta-fructofuranosidase, soluble isoenzyme I | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0005975 carbohydrate metabolic process Biological Process GO:0005985 sucrose metabolic process Biological Process GO:0009617 response to bacterium Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0071370 cellular response to gibberellin stimulus Biological Process GO:0080022 primary root development Biological Process GO:0000139 Golgi membrane Cellular Component GO:0000325 plant-type vacuole Cellular Component GO:0005773 vacuole Cellular Component GO:0005774 vacuolar membrane Cellular Component GO:0005775 vacuolar lumen Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G12240 sly:543992 vra:106768621 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF11837INV_N19-83 aaPF00251Glyco_hydro_32N115-201 aaPF26614DUF8194119-157 aaPF27613HI_1570120-127 aaPF27613HI_1570172-193 aaPF26614DUF8194183-203 aaPF00251Glyco_hydro_32N213-274 aaPF26614DUF8194242-250 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G004570 | PF11837 | INV_N | 19 | 83 | 0.018 | 16.3 |
| TkA06G004570 | PF00251 | Glyco_hydro_32N | 115 | 201 | 2.7e-29 | 103.4 |
| TkA06G004570 | PF26614 | DUF8194 | 119 | 157 | 0.2 | 12.4 |
| TkA06G004570 | PF27613 | HI_1570 | 120 | 127 | 0.021 | 15.5 |
| TkA06G004570 | PF27613 | HI_1570 | 172 | 193 | 0.021 | 15.5 |
| TkA06G004570 | PF26614 | DUF8194 | 183 | 203 | 0.2 | 12.4 |
| TkA06G004570 | PF00251 | Glyco_hydro_32N | 213 | 274 | 2.7e-29 | 103.4 |
| TkA06G004570 | PF26614 | DUF8194 | 242 | 250 | 0.2 | 12.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.