TkA05G464940 | RubberDandelionOmics

Gene overview

TkA05G464940

Reference: TK1151 Chr: Chr05 Coordinates: 116487116-116490749 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2982 bp · TkA05G464940|TK1151|cDNA

AAGAAACTAAGCAATACTCGAGGGAATATATTTGTAATATTGTCTGAATAGCTTTTAGGATACATTTTGTTAGGTTATGGAATGATTGCGTTCGGACCTTGATTCCATTGGAAACAAATGCAGTCAGGAAACTTCATTAGAGTATTGAGGCGCAAGCTGTGCTAGATCAACGTCAACTACACACGCAACTTCACTCAGTAACATCAATTCCATGGCGCTCTAGTAAGCGGTGGATTTCTAGCTTTTCTTATCCAATTCAA...

CDS

Download CDS FASTA

2205 bp · TkA05G464940|TK1151|CDS

ATGGAGAGATCTGATAGTAAAGACTGGAGTAGCATCAATAAGGGCTCTTTCTCAGAGGATAAACTCTTTGATGCTTCACAATATGCTTTTTTTGGTCGACAAACAGCTGAGAAGGTTGAGCTTGGATGCTTAGAAGAAGATGTAGATAATCCTTCAACTGGAATTCCCGATGATGAATACCATTTGTTTGATCGAGAAGAGGAACCAGGGACAGGATCCCTATCGGATTTAGATGATCTGTCAACTATATTTTCAAAGAT...

Protein

Download Protein FASTA

734 aa · TkA05G464940|TK1151|PROTEIN

MERSDSKDWSSINKGSFSEDKLFDASQYAFFGRQTAEKVELGCLEEDVDNPSTGIPDDEYHLFDREEEPGTGSLSDLDDLSTIFSKINRSVSGPRHPGVIGDRGSGSISRESSSASVDLPEWLDQHISDTESSHGSRRWSSQSHLPSDPKPLYRASSYPTEQHQFFTEPTLAPTSSLPSFSPGAHTSLHSPRHHSQIPFSDLNLSPLSNPSNLHLTSVPHGSRYGSTRTHPGLTQFAQSQAQWANHMLTNTLQQKLLLSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G464940`
TK1151 ID	TkA05G464940
OH-1004 ID	LXL04_022402
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G464940

Location Chr05:116487116-116490749 (+)

Description Similar to PAT1H1: Protein PAT1 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14990`	Activator of mRNA decapping.	No verified direct reference in this release
`At3g22270`	Activator of mRNA decapping.	Topoisomerase II-associated protein PAT1H1 is involved in the root stem cell niche maintenance in Arabidopsis thaliana.2016 · DOI: 10.1007/s00299-016-1961-7
`At1g79090`	Activator of mRNA decapping.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022402 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000290 deadenylation-dependent decapping of nuclear-transcribed mRNA Biological Process

GO:0006397 mRNA processing Biological Process

GO:0019827 stem cell population maintenance Biological Process

GO:0033962 P-body assembly Biological Process

GO:0045087 innate immune response Biological Process

GO:0051301 cell division Biological Process

GO:0000932 P-body Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G79090

ath:AT3G22270

ath:AT4G14990

dre:100009659

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.612

Rank 1 · TkA05G464940 · TK1151

Nucleus0.352

Rank 2 · TkA05G464940 · TK1151

Cell membrane0.073

Rank 3 · TkA05G464940 · TK1151

Lysosome / Vacuole0.071

Rank 4 · TkA05G464940 · TK1151

Golgi apparatus0.071

Rank 5 · TkA05G464940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28714ColD_2nd_Ig6-52 aa

PF28714ColD_2nd_Ig618-663 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G464940	`PF28714`	ColD_2nd_Ig	6	52	0.0058	16.8
TkA05G464940	`PF28714`	ColD_2nd_Ig	618	663	0.0058	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94C98`	Arabidopsis thaliana	sp\|Q94C98\|PATH2_ARATH Protein PAT1 homolog 2	46.800%	Swiss-Prot	Medium
`F4J077`	Arabidopsis thaliana	sp\|F4J077\|PATH1_ARATH Protein PAT1 homolog 1	47.100%	Swiss-Prot	Medium
`Q0WPK4`	Arabidopsis thaliana	sp\|Q0WPK4\|PAT1H_ARATH Protein PAT1 homolog	40.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card