TkA05G464740 | RubberDandelionOmics

Gene overview

TkA05G464740

Reference: TK1151 Chr: Chr05 Coordinates: 116424119-116439179 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1489 bp · TkA05G464740|TK1151|cDNA

AGTGCTACAAATTAAGATCTTGATTGATAAAAGGTTTAAAGTTTAGACGCAGAGGCGGTGTTTCCCCAATCCCCAACTCTTTCATAAACCAAAACCCATTGACAGAGGCAGCCGTTGCTTTTCAAAAACAAGAAAAGAAAACCTTCCTCTCAACCCCTCTTTCTCCTCTCAATTCCTCCACAATCCCATGATCAACAATCTCATGGTTTGACTTTGACTTTTCCCGTCAGTCATGGAGGAAGAATCATTATCCAGATCAC...

CDS

Download CDS FASTA

13938 bp · TkA05G464740|TK1151|CDS

ATGGAGGAAGAATCATTATCCAGATCACTCCTCCTGGAGGATTTTGGTCAGAAGGTGGATCTCACCAGGAGAATCAGAGAAGTTTTGTTGAATTACCCTGAAGGGACTACGGTTCTCAAGGAACTGATACAGAATGCCGACGACGCTGGCGCCACCAAAGTCTGCCTTTGCTTGGACCGTCGGTCTCACGCCACCGCCTCTCTCTTGTCCCCTAAACTCGTACAGTGGCAAGGCCCTGCTCTGTTAGCGTACAACAATGC...

Protein

Download Protein FASTA

4645 aa · TkA05G464740|TK1151|PROTEIN

MEEESLSRSLLLEDFGQKVDLTRRIREVLLNYPEGTTVLKELIQNADDAGATKVCLCLDRRSHATASLLSPKLVQWQGPALLAYNNAVFTEDDFASISRIGGSGKQSQAWKTGRFGVGFNSVYHLTDLPSFVSDKYVVLFDPQGDFLPNISTLNPGKRIDYVTSSAISRYQDQLSPYRAFGCNMETSFPGTIFRFPLRNESQAASSKLSKQAYLPDDISSMFEQLYEEAVFTLLFLKSVLSIEMYVWDTGMLEPKKTYSC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G464740`
TK1151 ID	TkA05G464740
OH-1004 ID	LXL04_022397
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G464740`
Location	Chr05:116424119-116439179 (+)
Description	Similar to Sacs: Sacsin
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022397` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0090084 negative regulation of inclusion body assembly Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0030544 Hsp70 protein binding Molecular Function GO:0042802 identical protein binding Molecular Function GO:0050750 low-density lipoprotein particle receptor binding Molecular Function GO:0051087 protein-folding chaperone binding Molecular Function GO:0070628 proteasome binding Molecular Function
KEGG gene cross-reference	mmu:50720 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.642

Rank 1 · TkA05G464740 · TK1151

Cytoplasm0.404

Rank 2 · TkA05G464740 · TK1151

Cell membrane0.049

Rank 3 · TkA05G464740 · TK1151

Mitochondrion0.048

Rank 4 · TkA05G464740 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA05G464740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25794SACS19-258 aa

PF13589HATPase_c_337-118 aa

PF25794SACS1384-1620 aa

PF13589HATPase_c_31405-1428 aa

PF25794SACS2753-2974 aa

PF13920zf-C3HC4_34598-4638 aa

PF24921RING_XB3-XBAT314598-4626 aa

PF14447Prok-RING_44599-4640 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G464740	`PF25794`	SACS	19	258	5e-199	659.3
TkA05G464740	`PF13589`	HATPase_c_3	37	118	0.08	13.7
TkA05G464740	`PF25794`	SACS	1384	1620	5e-199	659.3
TkA05G464740	`PF13589`	HATPase_c_3	1405	1428	0.08	13.7
TkA05G464740	`PF25794`	SACS	2753	2974	5e-199	659.3
TkA05G464740	`PF13920`	zf-C3HC4_3	4598	4638	3.9e-10	40.1
TkA05G464740	`PF24921`	RING_XB3-XBAT31	4598	4626	0.065	14.0
TkA05G464740	`PF14447`	Prok-RING_4	4599	4640	1.4e-06	28.8
TkA05G464740	`PF14634`	zf-RING_5	4599	4633	0.0018	18.9
TkA05G464740	`PF00097`	zf-C3HC4	4599	4632	0.002	18.6
TkA05G464740	`PF13639`	zf-RING_2	4599	4633	0.0092	16.9
TkA05G464740	`PF13923`	zf-C3HC4_2	4599	4632	0.15	12.6
TkA05G464740	`PF13445`	zf-RING_UBOX	4599	4623	0.23	12.2
TkA05G464740	`PF15227`	zf-C3HC4_4	4599	4626	2.0	9.3
TkA05G464740	`PF21362`	Sina_RING	4599	4632	2.6	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card