TkA05G457990 | RubberDandelionOmics

Gene overview

TkA05G457990

Reference: TK1151 Chr: Chr05 Coordinates: 114730596-114732628 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

937 bp · TkA05G457990|TK1151|cDNA

CTCCTCTGTCTTTTCTTTACAGACCCTAAATGGTAAGTACCAACCCCAGGAACACCATTTTACACCCGGTATCGATTTTAATTGACTGAGAAATACGATCCAGTTCGTGAAGCCCTAATTAATTCCAAGCAATGGCTCAGCCCAACAATACTGCTGGAGTTGACAACACCTTCAGAAGGAAATTCGACAAAGAAGAGTATCTGCAACGCGCTCGTGAGCGTGAAGAAAAGGAGTCAGAGAGCCGGTCTAAATCCAAAGGT...

CDS

Download CDS FASTA

507 bp · TkA05G457990|TK1151|CDS

ATGGCTCAGCCCAACAATACTGCTGGAGTTGACAACACCTTCAGAAGGAAATTCGACAAAGAAGAGTATCTGCAACGCGCTCGTGAGCGTGAAGAAAAGGAGTCAGAGAGCCGGTCTAAATCCAAAGGTCCTCCAGTGCAAAGGAAACCATTGAAGCATAGAGATTATGAAATTGACCTCACCACTCGCTTGGGGAAGACTCAGGTTGTCACTCCAATTGCCTCCCTTAACCAGCAGGCTGGATACTTTTGCTCTGTTTG...

Protein

Download Protein FASTA

168 aa · TkA05G457990|TK1151|PROTEIN

MAQPNNTAGVDNTFRRKFDKEEYLQRAREREEKESESRSKSKGPPVQRKPLKHRDYEIDLTTRLGKTQVVTPIASLNQQAGYFCSVCECVVKDSANYLDHINGKKHQRALGMSMRVERASLEQVQQRFENLKKRKDPGTFTEQDLDDGILKQQQEEEERKKQKRERKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G457990`
TK1151 ID	TkA05G457990
OH-1004 ID	LXL04_005623
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.700
Protein coverage (%)	TK1151 90.476 / OH-1004 76.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G457990`
Location	Chr05:114730596-114732628 (-)
Description	Similar to Zmat2: Zinc finger matrin-type protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005623` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0005829 cytosol Cellular Component GO:0046540 U4/U6 x U5 tri-snRNP complex Cellular Component GO:0071005 U2-type precatalytic spliceosome Cellular Component GO:0003676 nucleic acid binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	cel:CELE_ZK686.4 hsa:153527 mmu:66492 sce:YDL098C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.892

Rank 1 · TkA05G457990 · TK1151

Cytoplasm0.174

Rank 2 · TkA05G457990 · TK1151

Mitochondrion0.031

Rank 3 · TkA05G457990 · TK1151

Cell membrane0.014

Rank 4 · TkA05G457990 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA05G457990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09582AnfO_nitrog19-68 aa

PF05477SURF227-38 aa

PF12874zf-met82-106 aa

PF12171zf-C2H2_jaz82-107 aa

PF05477SURF282-164 aa

PF06220zf-U182-109 aa

PF25095C2H2-zf_KIN1782-108 aa

PF00096zf-C2H282-102 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G457990	`PF09582`	AnfO_nitrog	19	68	0.66	10.0
TkA05G457990	`PF05477`	SURF2	27	38	0.0037	17.6
TkA05G457990	`PF12874`	zf-met	82	106	1.7e-06	28.8
TkA05G457990	`PF12171`	zf-C2H2_jaz	82	107	2e-05	25.3
TkA05G457990	`PF05477`	SURF2	82	164	0.0037	17.6
TkA05G457990	`PF06220`	zf-U1	82	109	0.0053	17.2
TkA05G457990	`PF25095`	C2H2-zf_KIN17	82	108	0.094	13.7
TkA05G457990	`PF00096`	zf-C2H2	82	102	0.29	12.4
TkA05G457990	`PF09582`	AnfO_nitrog	84	138	0.66	10.0
TkA05G457990	`PF09582`	AnfO_nitrog	147	163	0.66	10.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card