TkA05G449310 | RubberDandelionOmics

Gene overview

TkA05G449310

Reference: TK1151 Chr: Chr05 Coordinates: 112321894-112323391 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1237 bp · TkA05G449310|TK1151|cDNA

CTTATATGACTTTCCCACGCCTTTTTATCCTTTTCGATGTTGATTCACAGCCACAACCACACTTTCGTCTATGTTGCAAACGACACTAGCTCCTCCTTCTACCACTCATATCAAACTGCTTTTCTGACACCCTTGCACTCGACCTATATACACCACACCAAGCTCAAGAACACGAAAAATCCATATCATCAATATGGCAATTCCTTCGGTGTTGCTAAACTTCATGTTTCCACCACCACCATCCTTATTCGTCACCACAA...

CDS

Download CDS FASTA

807 bp · TkA05G449310|TK1151|CDS

ATGGCAATTCCTTCGGTGTTGCTAAACTTCATGTTTCCACCACCACCATCCTTATTCGTCACCACAATGTCGGTCATCGGTCTTACGTCTTTATCAAATGCGGGGTACATGGAGATTAAAGGCAAGCATATGCAATATTCCAAATTCTTGAACGAGGGTGTTGCAAAGAAAGAGAATGATGCAAAGTTGTCGAGTAGAAACGGTATGCTTCTATCGTATACACCCGCGTTTCTTGTGGGCTTGGCTTCTTTAGTCGCGTT...

Protein

Download Protein FASTA

268 aa · TkA05G449310|TK1151|PROTEIN

MAIPSVLLNFMFPPPPSLFVTTMSVIGLTSLSNAGYMEIKGKHMQYSKFLNEGVAKKENDAKLSSRNGMLLSYTPAFLVGLASLVAFPDQDLRFMLLASALTVHFLKRALEVLFLHKYSGSMALESTIIITLSYTFSTATMIYAQYLSRDFPEPSLDLKYVGIGLFAVGIIGNFYHHYILANLRKDGEKEYKIPQGGLFDLVICPHYLFEILGYVGISCISQTLYAFSFTLGTIFYLTGRSYATRQWYLSKFGDKFPKDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G449310`
TK1151 ID	TkA05G449310
OH-1004 ID	LXL04_022178
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G449310

Location Chr05:112321894-112323391 (-)

Description Similar to gpsn2: Very-long-chain enoyl-CoA reductase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72590`	Plays a key role in early steps of protein N-linked glycosylation by being involved in the conversion of polyprenol into dolichol.	POLYPRENOL REDUCTASE2 Deficiency Is Lethal in Arabidopsis Due to Male Sterility.2015 · DOI: 10.1105/tpc.15.00463

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022178 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006665 sphingolipid metabolic process Biological Process

GO:0006694 steroid biosynthetic process Biological Process

GO:0006702 androgen biosynthetic process Biological Process

GO:0006710 androgen catabolic process Biological Process

GO:0008209 androgen metabolic process Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0014850 response to muscle activity Biological Process

GO:0016101 diterpenoid metabolic process Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0030154 cell differentiation Biological Process

GO:0030497 fatty acid elongation Biological Process

KEGG gene cross-reference

bdi:100827766

ddi:DDB_G0270270

ghi:107948867

mmu:78925

rno:24950

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.887

Rank 1 · TkA05G449310 · TK1151

Cytoplasm0.063

Rank 2 · TkA05G449310 · TK1151

Nucleus0.060

Rank 3 · TkA05G449310 · TK1151

Golgi apparatus0.043

Rank 4 · TkA05G449310 · TK1151

Mitochondrion0.042

Rank 5 · TkA05G449310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27843Seadorna_VP1118-50 aa

PF04191PEMT94-115 aa

PF02544Steroid_dh129-268 aa

PF06966DUF1295156-224 aa

PF04191PEMT161-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G449310	`PF27843`	Seadorna_VP11	18	50	0.34	11.8
TkA05G449310	`PF04191`	PEMT	94	115	0.064	14.4
TkA05G449310	`PF02544`	Steroid_dh	129	268	1.2e-30	107.2
TkA05G449310	`PF06966`	DUF1295	156	224	0.022	14.9
TkA05G449310	`PF04191`	PEMT	161	236	0.064	14.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAH5`	Arabidopsis thaliana	sp\|Q9CAH5\|PPRD1_ARATH Polyprenal reductase 1	34.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card