TkA05G428540 | RubberDandelionOmics

Gene overview

TkA05G428540

Reference: TK1151 Chr: Chr05 Coordinates: 106861258-106872607 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2561 bp · TkA05G428540|TK1151|cDNA

GTCAAGTGTCACTTTTATTGAGAAAATAAGGAATCGTTGCGTAGGTTTGTTGTGTGTCGGAGATGATCAACACGGAAAAGGCGCGCCTATAATTTCATCTTTCGCTCCTTTGGATCCAATCCATTTCCGGCGACCGGTGAGCGACGACCGACGACGGTTGATTGGGATCTCCGACAATTCAGTGAACAATTCCAACCCTATTTCTCGAAGTGTTAATTTCTGGCTACTTCCTTCTTAATCTGTTGAATCGAGACTGTCAC...

CDS

Download CDS FASTA

1905 bp · TkA05G428540|TK1151|CDS

ATGGTGTACACGTCATCAGACCTACCCCCTATAAGATCTTCTGTTCGCGATTTCATTTTTCCAAACTCTAGACACAAAAACACTCTAAGACTCTCTTCATCGCTTCAAGATCTCTCTACCTACAATCAACTTGATCCAGAACAAGGCCATGTTAACCATGGCGTTAACCGGTTTGACCAGTTTGATCAGCTTCATTTCTCAAAACCACCACAAAAATCTAGAAAGCTCGTAATTCTCCTCTGCTTCCTGTTTCTCGCTTC...

Protein

Download Protein FASTA

634 aa · TkA05G428540|TK1151|PROTEIN

MVYTSSDLPPIRSSVRDFIFPNSRHKNTLRLSSSLQDLSTYNQLDPEQGHVNHGVNRFDQFDQLHFSKPPQKSRKLVILLCFLFLASIIYTSIHLYSNWSKNSTRFFVVLDCGSTGTRVYIYQASINHQKNQNLPILLKSIPDNNPKPNSQTGRAYNRKETEPGLNKLLNNVTGLTHAINPLLTWAEKHIPKNAIKSTSLFLYATAGVRRLPVADSDSLMTNAWLIIKNSSFICKREWVKIISGTEEAFYGWIALNYHTR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G428540`
TK1151 ID	TkA05G428540
OH-1004 ID	LXL04_021837
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G428540

Location Chr05:106861258-106872607 (-)

Description Similar to APY7: Probable apyrase 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19180`	Catalyzes the hydrolysis of phosphoanhydride bonds of nucleoside tri- and di-phosphates (By similarity).	No verified direct reference in this release
`At2g02970`	Catalyzes the hydrolysis of phosphoanhydride bonds of nucleoside tri- and di-phosphates (By similarity).	No verified direct reference in this release
`At1g14230`	Catalyzes the hydrolysis of phosphoanhydride bonds of nucleoside tri- and di-phosphates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021837 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009134 nucleoside diphosphate catabolic process Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0030659 cytoplasmic vesicle membrane Cellular Component

GO:0004050 apyrase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0017110 nucleoside diphosphate phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT1G14230

ath:AT1G14240

ath:AT1G14250

ath:AT2G02970

ath:AT4G19180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.364

Rank 1 · TkA05G428540 · TK1151

Lysosome / Vacuole0.266

Rank 2 · TkA05G428540 · TK1151

Cytoplasm0.232

Rank 3 · TkA05G428540 · TK1151

Endoplasmic reticulum0.172

Rank 4 · TkA05G428540 · TK1151

Cell membrane0.151

Rank 5 · TkA05G428540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01150GDA1_CD39100-482 aa

PF02541Ppx-GppA239-354 aa

PF09015NgoMIV_restric301-400 aa

PF09015NgoMIV_restric438-486 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G428540	`PF01150`	GDA1_CD39	100	482	9.3e-60	203.2
TkA05G428540	`PF02541`	Ppx-GppA	239	354	0.14	12.3
TkA05G428540	`PF09015`	NgoMIV_restric	301	400	0.016	15.0
TkA05G428540	`PF09015`	NgoMIV_restric	438	486	0.016	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JSH1`	Arabidopsis thaliana	sp\|F4JSH1\|APY7_ARATH Probable apyrase 7	49.600%	Swiss-Prot	Medium
`O80612`	Arabidopsis thaliana	sp\|O80612\|APY6_ARATH Probable apyrase 6	28.200%	Swiss-Prot	Low
`Q8H1D8`	Arabidopsis thaliana	sp\|Q8H1D8\|APY4_ARATH Probable apyrase 4	25.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card