TkA05G414600 | RubberDandelionOmics

Gene overview

TkA05G414600

Reference: TK1151 Chr: Chr05 Coordinates: 103166102-103169007 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1403 bp · TkA05G414600|TK1151|cDNA

GGAGGTTGCATTTCTTTCATGTATCTGAAGAAATTTAAAAGTTGCATTTTTGTCATGTACATAAAAAAATCAAAAAATGGAAAAGATTAGTAAAACACTCCTTAACACGTGGTTCAGGTGCATGGAAAATACAAATCATATGTCTGTCAGTTTATCAAAACTCAACATTTCTCACGAATAAAAAAATAATAATAAATAAATAAAGGTCACACTCTTTTTGTCATGTTCTTCACGAGCTCACGCATTAAGAAACGCAAAGA...

CDS

Download CDS FASTA

750 bp · TkA05G414600|TK1151|CDS

ATGAGAAATAAGGCACGAAAAGAGGGGAAGATGGGACGATTACCGTGTTGCGATAAAGGCGAGGTGAAAAAAGGTGCTTGGACTCCTGAAGAAGACAGGATTCTTCTCGATTATATCACTAAAAACGGTCATGGCACTTGGCGTTCCTTCCCCAAACTTGCAGGTCTCCGGCGATGTGGAAAAAGTTGTAGACTGAGGTGGACAAACTACCTTCGCCCTGATATAAAACGGGGTACTTTTAGTTTTGAAGAAGAGCAAAC...

Protein

Download Protein FASTA

249 aa · TkA05G414600|TK1151|PROTEIN

MRNKARKEGKMGRLPCCDKGEVKKGAWTPEEDRILLDYITKNGHGTWRSFPKLAGLRRCGKSCRLRWTNYLRPDIKRGTFSFEEEQTIFQLHSLLGNKWAAIASRLPGRTDNEIKNYWNSHLRKRVPNKTPNLQSTSADTKQTSHMAEWESARVEAEARLAINVTENDHYFIKSWNSETGDAFQRGNESGVKMECESVITMQGDEGQNSNSYSPNSYKAEKSSDITLDLLLDFPNEGEYLEYLNDNNSA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G414600`
TK1151 ID	TkA05G414600
OH-1004 ID	LXL04_021663
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G414600

Location Chr05:103166102-103169007 (-)

Description Similar to MYB17: Transcription factor MYB17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g61250`	Transcription factor that may play a role in flower development by repressing ANT.	Characterization of Arabidopsis MYB transcription factor gene AtMYB17 and its possible regulation by LEAFY and AGL15.2009 · DOI: 10.1016/s1673-8527(08)60096-x LATE MERISTEM IDENTITY2 acts together with LEAFY to activate APETALA1.2011 · DOI: 10.1242/dev.063073
`At3g01140`	Functions as a repressor of epidermal cell outgrowth and negatively regulate trichome branch formation.	Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106.2008 · DOI: 10.1104/pp.108.126979 MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri.2013 · DOI: 10.1105/tpc.113.110783 The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.2013 · DOI: 10.4161/psb.26826
`At5g15310`	Involved in the control of epidermal cell morphogenesis in petals.	Control of cell and petal morphogenesis by R2R3 MYB transcription factors.2007 · DOI: 10.1242/dev.02836 MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri.2013 · DOI: 10.1105/tpc.113.110783 The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.2013 · DOI: 10.4161/psb.26826
`At4g05100`	Probable transcription factor that may function in salt stress response.	Salt-induced transcription factor MYB74 is regulated by the RNA-directed DNA methylation pathway in Arabidopsis.2015 · DOI: 10.1093/jxb/erv312
`At4g28110`	Transcription factor involved in salt stress response.	AtMyb41 regulates transcriptional and metabolic responses to osmotic stress in Arabidopsis.2009 · DOI: 10.1104/pp.108.134874 Phosphorylation by AtMPK6 is required for the biological function of AtMYB41 in Arabidopsis.2012 · DOI: 10.1016/j.bbrc.2012.04.137 AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types.2014 · DOI: 10.1111/tpj.12624

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021663 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000902 cell morphogenesis Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0010091 trichome branching Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0080090 regulation of primary metabolic process Biological Process

GO:0080091 regulation of raffinose metabolic process Biological Process

GO:1901957 regulation of cutin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT3G01140

ath:AT3G61250

ath:AT4G05100

ath:AT4G28110

ath:AT5G15310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.925

Rank 1 · TkA05G414600 · TK1151

Cytoplasm0.163

Rank 2 · TkA05G414600 · TK1151

Mitochondrion0.023

Rank 3 · TkA05G414600 · TK1151

Cell membrane0.019

Rank 4 · TkA05G414600 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA05G414600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249Myb_DNA-binding24-71 aa

PF13921Myb_DNA-bind_627-87 aa

PF00249Myb_DNA-binding77-122 aa

PF15963Myb_DNA-bind_780-148 aa

PF13921Myb_DNA-bind_681-126 aa

PF00249Myb_DNA-binding124-132 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G414600	`PF00249`	Myb_DNA-binding	24	71	2.2e-33	114.8
TkA05G414600	`PF13921`	Myb_DNA-bind_6	27	87	4.7e-21	75.4
TkA05G414600	`PF00249`	Myb_DNA-binding	77	122	2.2e-33	114.8
TkA05G414600	`PF15963`	Myb_DNA-bind_7	80	148	0.057	13.9
TkA05G414600	`PF13921`	Myb_DNA-bind_6	81	126	4.7e-21	75.4
TkA05G414600	`PF00249`	Myb_DNA-binding	124	132	2.2e-33	114.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2D9`	Arabidopsis thaliana	sp\|Q9M2D9\|MYB17_ARATH Transcription factor MYB17	57.600%	Swiss-Prot	Medium
`Q9LE63`	Arabidopsis thaliana	sp\|Q9LE63\|MY106_ARATH Transcription factor MYB106	64.600%	Swiss-Prot	Medium
`Q9LXF1`	Arabidopsis thaliana	sp\|Q9LXF1\|MYB16_ARATH Transcription factor MYB16	64.000%	Swiss-Prot	Medium
`Q9M0Y5`	Arabidopsis thaliana	sp\|Q9M0Y5\|MYB74_ARATH Transcription factor MYB74	75.200%	Swiss-Prot	Low
`Q9M0J5`	Arabidopsis thaliana	sp\|Q9M0J5\|MYB41_ARATH Transcription factor MYB41	75.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card