TkA05G410710 | RubberDandelionOmics

Gene overview

TkA05G410710

Reference: TK1151 Chr: Chr05 Coordinates: 102169364-102171200 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

498 bp · TkA05G410710|TK1151|cDNA

AGCACAAGATTAATTTCGCAACACCCTTCTTCTGAATCTGACCATCAGGAGGTCGACCAACACGAACAACCACCACCTCCTTCCCAAAATACACACATATACTTCCCTTCCTCTTCATCCTCCCACCACACCCATAACTTCCGTCACTCCCAACACACTCACTCCTCAGCTCGTACAACATCTGATGTTGAGGGGGAGCAACATCAAGACCATCAAACCCCTCCACATTCTCAGGGGGAGCATAAATCTCCCTCACGCAT...

CDS

Download CDS FASTA

498 bp · TkA05G410710|TK1151|CDS

AGCACAAGATTAATTTCGCAACACCCTTCTTCTGAATCTGACCATCAGGAGGTCGACCAACACGAACAACCACCACCTCCTTCCCAAAATACACACATATACTTCCCTTCCTCTTCATCCTCCCACCACACCCATAACTTCCGTCACTCCCAACACACTCACTCCTCAGCTCGTACAACATCTGATGTTGAGGGGGAGCAACATCAAGACCATCAAACCCCTCCACATTCTCAGGGGGAGCATAAATCTCCCTCACGCAT...

Protein

Download Protein FASTA

165 aa · TkA05G410710|TK1151|PROTEIN

STRLISQHPSSESDHQEVDQHEQPPPPSQNTHIYFPSSSSSHHTHNFRHSQHTHSSARTTSDVEGEQHQDHQTPPHSQGEHKSPSRIIDPTEGEQQSISSLLSQMQATLSSIDHKVSTLDTRLAAVERDVAAIKQVIAPLSSDDSVPETPPHNPPPPPPSPVTTQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G410710`
TK1151 ID	TkA05G410710
OH-1004 ID	LXL04_017224
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	62.000
Protein coverage (%)	TK1151 83.636 / OH-1004 23.205 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G410710`
Location	Chr05:102169364-102171200 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017224` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.815

Rank 1 · TkA05G410710 · TK1151

Cytoplasm0.414

Rank 2 · TkA05G410710 · TK1151

Mitochondrion0.030

Rank 3 · TkA05G410710 · TK1151

Cell membrane0.024

Rank 4 · TkA05G410710 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA05G410710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09731Mitofilin6-129 aa

PF06333Med13_C19-112 aa

PF05667CCDC22_CC38-136 aa

PF16046FAM7638-134 aa

PF23777GEMI5_RBS44-126 aa

PF08614ATG1650-132 aa

PF13094CENP-Q51-128 aa

PF14071YlbD_coat65-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G410710	`PF09731`	Mitofilin	6	129	1.7	8.2
TkA05G410710	`PF06333`	Med13_C	19	112	2.6	8.0
TkA05G410710	`PF05667`	CCDC22_CC	38	136	0.22	11.4
TkA05G410710	`PF16046`	FAM76	38	134	0.8	9.8
TkA05G410710	`PF23777`	GEMI5_RBS	44	126	0.52	10.2
TkA05G410710	`PF08614`	ATG16	50	132	8.2	7.3
TkA05G410710	`PF13094`	CENP-Q	51	128	1.9	9.3
TkA05G410710	`PF14071`	YlbD_coat	65	144	0.081	13.9
TkA05G410710	`PF13334`	DUF4094	68	125	0.14	13.3
TkA05G410710	`PF30828`	CEP83_CC_1st	90	137	0.03	14.2
TkA05G410710	`PF23991`	DUF7310	94	136	0.025	15.8
TkA05G410710	`PF07889`	DUF1664	97	141	0.12	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card