TkA05G409830 | RubberDandelionOmics

Gene overview

TkA05G409830

Reference: TK1151 Chr: Chr05 Coordinates: 101915310-101926562 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1481 bp · TkA05G409830|TK1151|cDNA

CACATGTGTGCTTCTCGTTGCACCATTTTCATCGTCTCCAACTAAGAAAAAAGAAACCCAAATACGCAAAGAGCAGAAAAAGTGCGCGACTGTGCGCTTTTCTGCACTGTGTCGGTTTTCTTCCTCCGTTCTTCGGTCGCCGGAAACTTTTTCATAGATTACACGTATACATAGCATTTCGATAATCAGAACTGACTCCATCACAGAGGCTGGAGCTGGACAAGAAAAGACGAGTATATGGAGGGAGACGCAGGAAGAGA...

CDS

Download CDS FASTA

1182 bp · TkA05G409830|TK1151|CDS

ATGGTATGCAGCAGTTACCTCAGGACAGTATTTATACAATCTGGGAATATTCAGAAAGTCACCGAGGGGTTGTTGAAGTTTCCAAGTTTCAGAAAAGGTCTGAAAACTGTTTCATCAGCAACCTTCTTATCTGATCGAATATTTCCATCTGGTAGAAGAATGATGGTGGATAATACCAGTGCAACATCTAACCGTGGCCCCACTATCAGCACTTCACCAGATAAAGATGATAATAATGGCTGTGCAAGTGGAGGATGGAA...

Protein

Download Protein FASTA

393 aa · TkA05G409830|TK1151|PROTEIN

MVCSSYLRTVFIQSGNIQKVTEGLLKFPSFRKGLKTVSSATFLSDRIFPSGRRMMVDNTSATSNRGPTISTSPDKDDNNGCASGGWKSEDGKLGCGYSSFRGKRASMEDFFDVKTCKINGETVCLFGIFDGHGGSRAAEYLKENLFKNLMNHPEFLTNTRVAISETYQQTDSDFLESGKDTFRDDGSTASTAVLVGNHLYVANVGDSRTVISKSGKAIPLSEDHKPNRSDERKRIENAGGVVMWAGTWRVGGVLAMSRAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G409830`
TK1151 ID	TkA05G409830
OH-1004 ID	LXL04_021599
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G409830

Location Chr05:101915310-101926562 (+)

Description Similar to At5g53140: Probable protein phosphatase 2C 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53120`	Spermine synthase.	No verified direct reference in this release
`At5g53140`	Probable protein phosphatase 2C 76.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0408700`	Spermidine synthase 1.	No verified direct reference in this release
`Os05g0587100`	Probable protein phosphatase 2C 52.	No verified direct reference in this release
`Os02g0255100`	Probable protein phosphatase that may play a role as a mitochondrial signal transduction mediator in pollen germination.	DCW11, down-regulated gene 11 in CW-type cytoplasmic male sterile rice, encoding mitochondrial protein phosphatase 2c is related to cytoplasmic male sterility.2008 · DOI: 10.1093/pcp/pcn036
`Os01g0618200`	Probable protein phosphatase 2C 7.	No verified direct reference in this release
`UniProt: Q0DBU3`	Probable protein phosphatase 2C 56.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021599 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009846 pollen germination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G31750

ath:AT5G53140

dosa:Os02g0255100

dosa:Os05g0587100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.615

Rank 1 · TkA05G409830 · TK1151

Cytoplasm0.174

Rank 2 · TkA05G409830 · TK1151

Plastid0.169

Rank 3 · TkA05G409830 · TK1151

Nucleus0.127

Rank 4 · TkA05G409830 · TK1151

Cell membrane0.048

Rank 5 · TkA05G409830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C95-333 aa

PF13672PP2C_2131-304 aa

PF05887Trypan_PARP344-390 aa

PF06390NESP55359-391 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G409830	`PF00481`	PP2C	95	333	3.1e-65	221.1
TkA05G409830	`PF13672`	PP2C_2	131	304	3.8e-05	24.1
TkA05G409830	`PF05887`	Trypan_PARP	344	390	0.41	11.4
TkA05G409830	`PF06390`	NESP55	359	391	0.039	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BN2`	Arabidopsis thaliana	sp\|Q94BN2\|SPSY_ARATH Spermine synthase	75.800%	Swiss-Prot	High
`Q94AT1`	Arabidopsis thaliana	sp\|Q94AT1\|P2C76_ARATH Probable protein phosphatase 2C 76	66.300%	Swiss-Prot	High
`Q9SMB1`	Oryza sativa subsp. japonica	sp\|Q9SMB1\|SPDS1_ORYSJ Spermidine synthase 1	65.700%	Swiss-Prot	High
`Q6L5C4`	Oryza sativa subsp. japonica	sp\|Q6L5C4\|P2C52_ORYSJ Probable protein phosphatase 2C 52	80.600%	Swiss-Prot	Medium
`Q6EN45`	Oryza sativa subsp. japonica	sp\|Q6EN45\|P2C13_ORYSJ Probable protein phosphatase 2C member 13, mitochondrial	76.700%	Swiss-Prot	Medium
`Q0JL75`	Oryza sativa subsp. japonica	sp\|Q0JL75\|P2C07_ORYSJ Probable protein phosphatase 2C 7	69.100%	Swiss-Prot	Medium
`Q0DBU3`	Oryza sativa subsp. japonica	sp\|Q0DBU3\|P2C56_ORYSJ Probable protein phosphatase 2C 56	56.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card