TkA05G408210 | RubberDandelionOmics

Gene overview

TkA05G408210

Reference: TK1151 Chr: Chr05 Coordinates: 101499736-101501829 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · TkA05G408210|TK1151|cDNA

TGTTACGTGATCATCTGGTTCAAGTTCCTCAACCCTACGCCTATTTCCGGCTATCTTCTTCACCGAATCACCGGCGCCGATTTCATCCTCCCTCCTTTCTCTTTCACGCATTCTTACCCTCTAATCCCTTTACCTTCTTACTGAAATTTAGGGTTTTAGGTATCTTTTCAAACACTCATCGTTTACATTTCTGAAAGCTCGATTATGCATTTAGTTTACAGAGCAAACTAAAATCCCAAACTCTAACTCGCCATTCTTAT...

CDS

Download CDS FASTA

975 bp · TkA05G408210|TK1151|CDS

ATGGCTATGGCTGACTGGCAACAGTACACGCAATCAGTGGTATTCGGTCTTGTTTTCTCCTTTCTTCTTGCTAAACTCTTCTCGATAATCTTCTCTTTCCGAGATGAAAATGAAAACCTCGGGAACCCTAGCGAAGTCGTAACTCCATCGGAACCCCATTGGAAATCGGCAGAAGACGATAAAATCTCAGACGCGGAGTTCGCTGGGAAACGTATTACTAGCGGCGAAGAAGAGCCGTTGGTTGATCAACAAAAGAAAGT...

Protein

Download Protein FASTA

324 aa · TkA05G408210|TK1151|PROTEIN

MAMADWQQYTQSVVFGLVFSFLLAKLFSIIFSFRDENENLGNPSEVVTPSEPHWKSAEDDKISDAEFAGKRITSGEEEPLVDQQKKVADTGSDSDGDWEGVESTELDEAFCAASAFVAAAAVADRSFPKLSNENKLQLYGLYKIATEGPCTVPQPSAIKMNARVKWNSWNKLGAMPTEEAMHKYLEIITELYPNWADGLKSKTRSVDSNEHEEPVNGNETKMEAIHDFAKEGDIKNLLKCLESGVSINTKDSEGRTPLHW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G408210`
TK1151 ID	TkA05G408210
OH-1004 ID	LXL04_021583
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G408210

Location Chr05:101499736-101501829 (+)

Description Similar to ACBP2: Acyl-CoA-binding domain-containing protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53470`	Binds medium- and long-chain acyl-CoA esters with very high affinity.	Arabidopsis ACBP3 is an extracellularly targeted acyl-CoA-binding protein.2006 · DOI: 10.1007/s00425-005-0139-2 Overexpression of membrane-associated acyl-CoA-binding protein ACBP1 enhances lead tolerance in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2008.03402.x Acyl-CoA-Binding Protein ACBP1 Modulates Sterol Synthesis during Embryogenesis.2017 · DOI: 10.1104/pp.17.00412 Arabidopsis ACYL-COA-BINDING PROTEIN1 interacts with STEROL C4-METHYL OXIDASE1-2 to modulate gene expression of homeodomain-leucine zipper IV transcription factors.2018 · DOI: 10.1111/nph.14965
`At4g27780`	Binds medium- and long-chain acyl-CoA esters with very high affinity.	Single amino acid substitutions at the acyl-CoA-binding domain interrupt 14[C]palmitoyl-CoA binding of ACBP2, an Arabidopsis acyl-CoA-binding protein with ankyrin repeats.2000 · DOI: 10.1023/a:1026524108095 ACBP4 and ACBP5, novel Arabidopsis acyl-CoA-binding proteins with kelch motifs that bind oleoyl-CoA.2004 · DOI: 10.1007/s11103-004-0642-z Overexpression of membrane-associated acyl-CoA-binding protein ACBP1 enhances lead tolerance in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2008.03402.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0681900`	Binds medium- and long-chain acyl-CoA esters with high affinity.	The rice acyl-CoA-binding protein gene family: phylogeny, expression and functional analysis.2011 · DOI: 10.1111/j.1469-8137.2010.03546.x Subcellular localization of rice acyl-CoA-binding proteins (ACBPs) indicates that OsACBP6::GFP is targeted to the peroxisomes.2014 · DOI: 10.1111/nph.12809

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021583 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0006869 lipid transport Biological Process

GO:0009409 response to cold Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010288 response to lead ion Biological Process

GO:0048316 seed development Biological Process

GO:0055089 fatty acid homeostasis Biological Process

GO:0055092 sterol homeostasis Biological Process

GO:1900140 regulation of seedling development Biological Process

KEGG gene cross-reference

ath:AT4G27780

ath:AT5G53470

dosa:Os04g0681900

dre:324090

hsa:84320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.312

Rank 1 · TkA05G408210 · TK1151

Nucleus0.204

Rank 2 · TkA05G408210 · TK1151

Cytoplasm0.200

Rank 3 · TkA05G408210 · TK1151

Golgi apparatus0.151

Rank 4 · TkA05G408210 · TK1151

Plastid0.130

Rank 5 · TkA05G408210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF000037tm_37-39 aa

PF00887ACBP108-187 aa

PF00887ACBP212-235 aa

PF13857Ank_5212-259 aa

PF24521Ank_KRIT1217-308 aa

PF13637Ank_4225-274 aa

PF00023Ank225-251 aa

PF12796Ank_2226-316 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G408210	`PF00003`	7tm_3	7	39	0.15	12.4
TkA05G408210	`PF00887`	ACBP	108	187	2e-24	86.3
TkA05G408210	`PF00887`	ACBP	212	235	2e-24	86.3
TkA05G408210	`PF13857`	Ank_5	212	259	4.3e-16	59.5
TkA05G408210	`PF24521`	Ank_KRIT1	217	308	7.9e-07	29.6
TkA05G408210	`PF13637`	Ank_4	225	274	5.5e-26	90.8
TkA05G408210	`PF00023`	Ank	225	251	2.9e-19	68.8
TkA05G408210	`PF12796`	Ank_2	226	316	2.3e-18	67.3
TkA05G408210	`PF13857`	Ank_5	244	294	4.3e-16	59.5
TkA05G408210	`PF13606`	Ank_3	253	281	9.1e-14	50.8
TkA05G408210	`PF00023`	Ank	254	285	2.9e-19	68.8
TkA05G408210	`PF13637`	Ank_4	258	307	5.5e-26	90.8
TkA05G408210	`PF00023`	Ank	287	318	2.9e-19	68.8
TkA05G408210	`PF13606`	Ank_3	287	312	9.1e-14	50.8
TkA05G408210	`PF13857`	Ank_5	289	319	4.3e-16	59.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SM23`	Arabidopsis thaliana	sp\|Q9SM23\|ACBP1_ARATH Acyl-CoA-binding domain-containing protein 1	52.100%	Swiss-Prot	High
`Q9STP8`	Arabidopsis thaliana	sp\|Q9STP8\|ACBP2_ARATH Acyl-CoA-binding domain-containing protein 2	50.500%	Swiss-Prot	High
`A3AYR1`	Oryza sativa subsp. japonica	sp\|A3AYR1\|ACBP4_ORYSJ Acyl-CoA-binding domain-containing protein 4	44.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card