TkA05G384900 | RubberDandelionOmics

Gene overview

TkA05G384900

Reference: TK1151 Chr: Chr05 Coordinates: 95644100-95648075 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3294 bp · TkA05G384900|TK1151|cDNA

CTACCTTTCATCCACCGCCATTAATATATACAAGAATGAGACAATCCAAAAAGCGTGGTGTTTTATAAAATGGAAGCTGAACAAAAATACAAGCCCTAATTCCAACTTACCACAATCAATGCTTGGATTGATGTATTGCGTGCACCAAACTAAACTGTGGGACCAAATGGAATCCTCACATGATCTTTAACATACTGCCATTATCTTATCACTACTGCCCTAAACCCTTCCCTTCTTTCTTCCTATATATACACCTTCCT...

CDS

Download CDS FASTA

2934 bp · TkA05G384900|TK1151|CDS

ATGATCTTTAACATACTGCCATTATCTTATCACTACTGCCCTAAACCCTTCCCTTCTTTCTTCCTATATATACACCTTCCTTTACCCTTCCCACATCACCACCTTAAAACACCAACAATGGTGTCTTCTTCTCCGGCGGCGGTACCCATCTTTTACCTTACGGTGTTTCTTGTTATATCTTCATGTATAACTGGTACCTTTTCCCAAGCCACTCCGGCGACTTCACCACCCACCAAGATCGGCAATGGCTACACTCTCGT...

Protein

Download Protein FASTA

977 aa · TkA05G384900|TK1151|PROTEIN

MIFNILPLSYHYCPKPFPSFFLYIHLPLPFPHHHLKTPTMVSSSPAAVPIFYLTVFLVISSCITGTFSQATPATSPPTKIGNGYTLVSLQESSDGGLVGRLQVNRRNYIYGADIPFLQLYIKHETDDRLRVHISDAQQQRWEVPYDILPRDKPPTPSTQTIGRSRQNPITVSEFSGGELIFSCISNPFSFAVRRKSNGETLFNSTSDQSAPYNSLVFKDQYLEISTSLPKDASLYGLGENTQPHGIKLNPNEPYTLWTTD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G384900`
TK1151 ID	TkA05G384900
OH-1004 ID	LXL04_021371
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G384900

Location Chr05:95644100-95648075 (-)

Description Similar to XYL1: Alpha-xylosidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68560`	Glycoside hydrolase releasing xylosyl residues from xyloglucan oligosaccharides at the non-reducing end.	AXY3 encodes a α-xylosidase that impacts the structure and accessibility of the hemicellulose xyloglucan in Arabidopsis plant cell walls.2011 · DOI: 10.1007/s00425-010-1330-7
`At3g45940`	Putative alpha-xylosidase 2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0675700`	Probable alpha-glucosidase Os06g0675700.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021371 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0010411 xyloglucan metabolic process Biological Process

GO:0045493 xylan catabolic process Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G68560

ath:AT3G45940

dosa:Os06g0675700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.480

Rank 1 · TkA05G384900 · TK1151

Extracellular0.222

Rank 2 · TkA05G384900 · TK1151

Endoplasmic reticulum0.121

Rank 3 · TkA05G384900 · TK1151

Cytoplasm0.119

Rank 4 · TkA05G384900 · TK1151

Cell membrane0.096

Rank 5 · TkA05G384900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13802Gal_mutarotas_2125-298 aa

PF01055Glyco_hydro_31_2nd342-715 aa

PF21365Glyco_hydro_31_3rd723-812 aa

PF09611Cas_Csy1899-952 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G384900	`PF13802`	Gal_mutarotas_2	125	298	8.4e-14	53.0
TkA05G384900	`PF01055`	Glyco_hydro_31_2nd	342	715	4.6e-121	404.8
TkA05G384900	`PF21365`	Glyco_hydro_31_3rd	723	812	2.8e-20	73.3
TkA05G384900	`PF09611`	Cas_Csy1	899	952	0.39	10.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7Y7`	Arabidopsis thaliana	sp\|Q9S7Y7\|XYL1_ARATH Alpha-xylosidase 1	70.900%	Swiss-Prot	High
`F4J6T7`	Arabidopsis thaliana	sp\|F4J6T7\|XYL2_ARATH Putative alpha-xylosidase 2	64.100%	Swiss-Prot	High
`Q653V7`	Oryza sativa subsp. japonica	sp\|Q653V7\|AGLU_ORYSJ Probable alpha-glucosidase Os06g0675700	52.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card