TkA05G378560 | RubberDandelionOmics

Gene overview

TkA05G378560

Reference: TK1151 Chr: Chr05 Coordinates: 94047093-94048261 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

757 bp · TkA05G378560|TK1151|cDNA

GCCTTGAATATTGGACATTCGATATGGTTGTGTTGTTATCCGGTCTTCTCCCAAATCCAAAGTTAGAGACATCCGTATTATCAATCACCCTTAATACATGTTGGATGGTGTATATGATTTCTGTCGGTCTTGGGGGTGCAATAAGTACAAGAGTTTCAAATGAATTAGGGGCGGCGAGACCTAAAGGTGCACGTTTGGCTGTTTGTGTTGTGGTTGTGATAGCAATTTTGGAGGGTGTGCTAATTGGAATTGTTACTATT...

CDS

Download CDS FASTA

615 bp · TkA05G378560|TK1151|CDS

ATGGTTGTGTTGTTATCCGGTCTTCTCCCAAATCCAAAGTTAGAGACATCCGTATTATCAATCACCCTTAATACATGTTGGATGGTGTATATGATTTCTGTCGGTCTTGGGGGTGCAATAAGTACAAGAGTTTCAAATGAATTAGGGGCGGCGAGACCTAAAGGTGCACGTTTGGCTGTTTGTGTTGTGGTTGTGATAGCAATTTTGGAGGGTGTGCTAATTGGAATTGTTACTATTTTGGTACGAAATGTTTGGGGGAA...

Protein

Download Protein FASTA

204 aa · TkA05G378560|TK1151|PROTEIN

MVVLLSGLLPNPKLETSVLSITLNTCWMVYMISVGLGGAISTRVSNELGAARPKGARLAVCVVVVIAILEGVLIGIVTILVRNVWGKLYSNDEEVIKYVAKMMPLLALSDFLDGFQCVLSGAARGCGWQNVCAIINLGAYYVVGIPCALLFAFVLHVGGMGLWMGVICALSVQVVALIAINLSTNWNDEAWKAINRVQTSIGIV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G378560`
TK1151 ID	TkA05G378560
OH-1004 ID	LXL04_021305
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	48.500
Protein coverage (%)	TK1151 95.098 / OH-1004 37.891 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G378560

Location Chr05:94047093-94048261 (-)

Description Similar to DTX14: Protein DETOXIFICATION 14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g52450`	Protein DETOXIFICATION 16.	No verified direct reference in this release
`At1g73700`	Protein DETOXIFICATION 17.	No verified direct reference in this release
`At2g34360`	Protein DETOXIFICATION 15.	No verified direct reference in this release
`At1g15180`	Protein DETOXIFICATION 13.	No verified direct reference in this release
`At1g15170`	Protein DETOXIFICATION 12.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021305 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042908 xenobiotic transport Biological Process

GO:1990961 xenobiotic detoxification by transmembrane export across the plasma membrane Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

GO:0042910 xenobiotic transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G15150

ath:AT1G15160

ath:AT1G15170

ath:AT1G15180

ath:AT1G71140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.466

Rank 1 · TkA05G378560 · TK1151

Lysosome / Vacuole0.260

Rank 2 · TkA05G378560 · TK1151

Endoplasmic reticulum0.106

Rank 3 · TkA05G378560 · TK1151

Cytoplasm0.086

Rank 4 · TkA05G378560 · TK1151

Golgi apparatus0.073

Rank 5 · TkA05G378560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01554MatE4-148 aa

PF14015DUF423137-71 aa

PF14015DUF4231147-198 aa

PF01554MatE160-177 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G378560	`PF01554`	MatE	4	148	4.3e-27	95.5
TkA05G378560	`PF14015`	DUF4231	37	71	7.2	7.8
TkA05G378560	`PF14015`	DUF4231	147	198	7.2	7.8
TkA05G378560	`PF01554`	MatE	160	177	4.3e-27	95.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHB6`	Arabidopsis thaliana	sp\|Q9FHB6\|DTX16_ARATH Protein DETOXIFICATION 16	62.100%	Swiss-Prot	High
`Q9C9U1`	Arabidopsis thaliana	sp\|Q9C9U1\|DTX17_ARATH Protein DETOXIFICATION 17	56.500%	Swiss-Prot	High
`F4IHU9`	Arabidopsis thaliana	sp\|F4IHU9\|DTX15_ARATH Protein DETOXIFICATION 15	56.500%	Swiss-Prot	High
`Q94AL1`	Arabidopsis thaliana	sp\|Q94AL1\|DTX13_ARATH Protein DETOXIFICATION 13	47.500%	Swiss-Prot	Medium
`Q8L731`	Arabidopsis thaliana	sp\|Q8L731\|DTX12_ARATH Protein DETOXIFICATION 12	45.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card