TkA05G369110 | RubberDandelionOmics

Gene overview

TkA05G369110

Reference: TK1151 Chr: Chr05 Coordinates: 91645253-91648715 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2011 bp · TkA05G369110|TK1151|cDNA

AAACAAAATACATGTGTTAAAAATGAAAACATCACCTGTGGCCAGTAAGATCGAAGACAAGGACAATGCGGTCATTTGATACTCATACTCATGTGAAAGAAGAAGATTCAGAAGTGTGGCCAGTAAGATCGAACTCGATCATGGCTTTCCCGTCACCATGGAGATGGCCACGGCAGAGCTCATCAGCAAAACATTCATCATTAATCGGATCCTCATCCTTCATTTCATCCTCAATTTCCGTCTATCCTTTCATCTTCTCT...

CDS

Download CDS FASTA

912 bp · TkA05G369110|TK1151|CDS

ATGGACCCTGCAGCATTCACTGTTGTGAGATTTACAGTTTCTGCCATTCCATTTCTCCCATTTGTTTTGGAGATCTTGGGGAGATTTCAAATTCGCAATTCAGGAATGGAGTTGGGGTTTTGGGTCAGTTTAGGGTATCTCATGCAGGCCCTTGGACTGCTCACATCTGATGCTGGACGTGCATCCTTCATTTCCATGTTTACTGTGATTGTGGTTCCATTGATTGATGGGTTGCTAGGAGCAGTGATTCCTGCTCGCAC...

Protein

Download Protein FASTA

303 aa · TkA05G369110|TK1151|PROTEIN

MDPAAFTVVRFTVSAIPFLPFVLEILGRFQIRNSGMELGFWVSLGYLMQALGLLTSDAGRASFISMFTVIVVPLIDGLLGAVIPARTWFGALMSIVGVGMLECSGSSPCIGDLFNFLSALFFGIHMLRTEHISRKTEKENIMAVLGYEVCMVAISSVLWFFIDGGLDYHPSSWTLPMLMKWGMEFPWIPALYTGVFSTGVCLWVEMAAMRDISATETAIIYGLEPVWGACFAWFLLNERWGVYGWFGAALVLGGSLVVQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G369110`
TK1151 ID	TkA05G369110
OH-1004 ID	LXL04_021229
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 66.447 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G369110`
Location	Chr05:91645253-91648715 (-)
Description	Similar to AF_0788: Uncharacterized transporter AF_0788 (Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021229` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference	afu:AF_0788 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.339

Rank 1 · TkA05G369110 · TK1151

Lysosome / Vacuole0.299

Rank 2 · TkA05G369110 · TK1151

Endoplasmic reticulum0.182

Rank 3 · TkA05G369110 · TK1151

Cell membrane0.115

Rank 4 · TkA05G369110 · TK1151

Cytoplasm0.107

Rank 5 · TkA05G369110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892EamA1-100 aa

PF06686SpoIIIAC42-72 aa

PF27362TP_007086-143 aa

PF06027SLC35F92-154 aa

PF06686SpoIIIAC108-118 aa

PF00892EamA110-258 aa

PF04142Nuc_sug_transp207-275 aa

PF06027SLC35F231-274 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G369110	`PF00892`	EamA	1	100	4.1e-21	76.4
TkA05G369110	`PF06686`	SpoIIIAC	42	72	0.12	13.3
TkA05G369110	`PF27362`	TP_0070	86	143	0.09	14.0
TkA05G369110	`PF06027`	SLC35F	92	154	0.0044	17.3
TkA05G369110	`PF06686`	SpoIIIAC	108	118	0.12	13.3
TkA05G369110	`PF00892`	EamA	110	258	4.1e-21	76.4
TkA05G369110	`PF04142`	Nuc_sug_transp	207	275	0.014	15.3
TkA05G369110	`PF06027`	SLC35F	231	274	0.0044	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card