TkA05G364750 | RubberDandelionOmics

Gene overview

TkA05G364750

Reference: TK1151 Chr: Chr05 Coordinates: 90519542-90522174 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

765 bp · TkA05G364750|TK1151|cDNA

ATGCCTTCGATGAATTTGTCTGTTTGTAGGTGGAGTAAAGGGGAGCAATCGGCCGCTTTAGCCACCGCAACCGCAACCGACTCCACCTTACAGGAATTATACGAGTTGAATTCTCAATACAAGCAAGAGTTTGGATTCGTTTTATTTATATGTGCATCTAGAAGGAGTACTCCAGAAATATTAGCTGAGTTGAAGAAACGTTTTTCAAACAGGCCAATTGTTGAGCTTGAAATTGCATCCCAAGAACAAATGAAAATAAC...

CDS

Download CDS FASTA

765 bp · TkA05G364750|TK1151|CDS

ATGCCTTCGATGAATTTGTCTGTTTGTAGGTGGAGTAAAGGGGAGCAATCGGCCGCTTTAGCCACCGCAACCGCAACCGACTCCACCTTACAGGAATTATACGAGTTGAATTCTCAATACAAGCAAGAGTTTGGATTCGTTTTATTTATATGTGCATCTAGAAGGAGTACTCCAGAAATATTAGCTGAGTTGAAGAAACGTTTTTCAAACAGGCCAATTGTTGAGCTTGAAATTGCATCCCAAGAACAAATGAAAATAAC...

Protein

Download Protein FASTA

254 aa · TkA05G364750|TK1151|PROTEIN

MPSMNLSVCRWSKGEQSAALATATATDSTLQELYELNSQYKQEFGFVLFICASRRSTPEILAELKKRFSNRPIVELEIASQEQMKITELRLHKLFTNTSIQVQKSQVTSPKQKMDMKRILKISKLTFLNFVGVFSCRLPQVRVIIFGIQIIQCSNRDKLLYTLAILKLDLVQKIVLIFTNTIDSSFRLKLYLEQFGIKSSVLNADLHVHSRLHILEGFNAGLFDYLIATDDSDSKEKEKTDENTQKERKKVKKK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G364750`
TK1151 ID	TkA05G364750
OH-1004 ID	LXL04_006635
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.200
Protein coverage (%)	TK1151 40.157 / OH-1004 17.172 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G364750

Location Chr05:90519542-90522174 (+)

Description Similar to RH16: DEAD-box ATP-dependent RNA helicase 16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g34910`	DEAD-box ATP-dependent RNA helicase 16.	No verified direct reference in this release
`At5g58220`	Involved in the last two steps of the degradation of uric acid, i.e. the hydrolysis of 5-hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) and its stereoselective decarboxylation to (S)-allantoin, a major ureide compound.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0728800`	DEAD-box ATP-dependent RNA helicase 16.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006635 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003678 DNA helicase activity Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0033677 DNA/RNA helicase activity Molecular Function

KEGG gene cross-reference

act:ACLA_073630

aor:AO090026000163

ath:AT4G34910

dosa:Os03g0728800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · TkA05G364750 · TK1151

Mitochondrion0.206

Rank 2 · TkA05G364750 · TK1151

Nucleus0.195

Rank 3 · TkA05G364750 · TK1151

Peroxisome0.160

Rank 4 · TkA05G364750 · TK1151

Endoplasmic reticulum0.075

Rank 5 · TkA05G364750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09349OHCU_decarbox10-91 aa

PF00271Helicase_C47-63 aa

PF05634APO_RNA-bind58-155 aa

PF00271Helicase_C172-230 aa

PF21090P-loop_SecA172-209 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G364750	`PF09349`	OHCU_decarbox	10	91	2.2e-19	71.3
TkA05G364750	`PF00271`	Helicase_C	47	63	1.2e-05	26.3
TkA05G364750	`PF05634`	APO_RNA-bind	58	155	0.06	13.5
TkA05G364750	`PF00271`	Helicase_C	172	230	1.2e-05	26.3
TkA05G364750	`PF21090`	P-loop_SecA	172	209	0.018	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SW44`	Arabidopsis thaliana	sp\|Q9SW44\|RH16_ARATH DEAD-box ATP-dependent RNA helicase 16	67.400%	Swiss-Prot	Low
`Q9LVM5`	Arabidopsis thaliana	sp\|Q9LVM5\|TTHL_ARATH Uric acid degradation bifunctional protein TTL	58.300%	Swiss-Prot	Low
`Q6ATJ8`	Oryza sativa subsp. japonica	sp\|Q6ATJ8\|RH16_ORYSJ DEAD-box ATP-dependent RNA helicase 16	60.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card