TkA05G358720 | RubberDandelionOmics

Gene overview

TkA05G358720

Reference: TK1151 Chr: Chr05 Coordinates: 89039848-89043776 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1742 bp · TkA05G358720|TK1151|cDNA

ATTTGGCTTACTTAAAAGAACCAACATCAAACATAAGAAACCATCGTTTGTTTGATTACTGTAATAACTACCCAACAAATAAAAACGGGTGATAAACATAAACCTATTGTTACCGAAACTCTTTCGGCCCTCTTACGTATCATCCATCCTCACCGCCGAAGTTTCATGTTTCACCGTAATCAGACTTCAAATCTTGAAATTCATGCATAACCCCTCATCCTTTAATCGAAACGTTCACTGCTCTCCATGGGATCCAGTTC...

CDS

Download CDS FASTA

1320 bp · TkA05G358720|TK1151|CDS

ATGGAAGAATCACAGGAGCCAGTTCTTCAATCCAACAACATAGAATCTAGCAATGGGAATGGGAATGGGAATGGATATAGCTCAAGATTCAACTTAAATAACCGTGGGAGGCAGAACTTCATAGGACCTGGTTTTCCAGGGTTAAAAAAGAGAGGTCATGCACATGGAAACCGATCATGGATAAAAATAGAGGAAAATGGGAACTCAAAAGTGGTGGAATTAGATAAAGCAAGTGTAATGAGACAGTGTTGTTTGCCAGC...

Protein

Download Protein FASTA

439 aa · TkA05G358720|TK1151|PROTEIN

MEESQEPVLQSNNIESSNGNGNGNGYSSRFNLNNRGRQNFIGPGFPGLKKRGHAHGNRSWIKIEENGNSKVVELDKASVMRQCCLPARDLRLLDPLFIYPSTILGREKAIVVSLEQIRCIITADEVFLMNSLDASVVQYKSELCKRLQEEKCHSDDLPFEFRALELALEFTCLGLDTQVKELEMEIHPVLDELAKSISTLNLERVRRFKGHLLALTQRVQKVCDEIEHLMNDDGDMAEMYLTEKKQKDSCTDLYDQVQGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G358720`
TK1151 ID	TkA05G358720
OH-1004 ID	LXL04_036913
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	40.500
Protein coverage (%)	TK1151 87.016 / OH-1004 93.401 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G358720

Location Chr05:89039848-89043776 (-)

Description Similar to MRS2-I: Magnesium transporter MRS2-I

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03620`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`At1g16010`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`At1g80900`	High-affinity magnesium transporter that mediates the influx of magnesium.	A novel family of magnesium transport genes in Arabidopsis.2001 · DOI: 10.1105/tpc.010352 Overexpression of an Arabidopsis magnesium transport gene, AtMGT1, in Nicotiana benthamiana confers Al tolerance.2006 · DOI: 10.1093/jxb/erl201

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YFN7`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`Os06g0650800`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036913 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0015693 magnesium ion transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015095 magnesium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT5G09690

ath:AT5G64560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.381

Rank 1 · TkA05G358720 · TK1151

Cytoplasm0.198

Rank 2 · TkA05G358720 · TK1151

Lysosome / Vacuole0.168

Rank 3 · TkA05G358720 · TK1151

Endoplasmic reticulum0.143

Rank 4 · TkA05G358720 · TK1151

Nucleus0.119

Rank 5 · TkA05G358720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22099MRS2-like65-248 aa

PF01544CorA154-258 aa

PF14712Snapin_Pallidin176-229 aa

PF26012HH_RND_rel177-223 aa

PF03013Pyr_excise190-228 aa

PF14712Snapin_Pallidin311-356 aa

PF22099MRS2-like320-363 aa

PF01544CorA331-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G358720	`PF22099`	MRS2-like	65	248	3.1e-36	125.5
TkA05G358720	`PF01544`	CorA	154	258	0.00023	21.3
TkA05G358720	`PF14712`	Snapin_Pallidin	176	229	0.3	12.3
TkA05G358720	`PF26012`	HH_RND_rel	177	223	0.1	13.6
TkA05G358720	`PF03013`	Pyr_excise	190	228	0.049	14.7
TkA05G358720	`PF14712`	Snapin_Pallidin	311	356	0.3	12.3
TkA05G358720	`PF22099`	MRS2-like	320	363	3.1e-36	125.5
TkA05G358720	`PF01544`	CorA	331	432	0.00023	21.3
TkA05G358720	`PF26012`	HH_RND_rel	340	369	0.1	13.6
TkA05G358720	`PF09946`	DUF2178	381	434	0.012	16.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZPR4`	Arabidopsis thaliana	sp\|Q9ZPR4\|MRS25_ARATH Magnesium transporter MRS2-5	68.100%	Swiss-Prot	High
`Q9S9N4`	Arabidopsis thaliana	sp\|Q9S9N4\|MRS21_ARATH Magnesium transporter MRS2-1	55.200%	Swiss-Prot	High
`Q9SAH0`	Arabidopsis thaliana	sp\|Q9SAH0\|MRS2A_ARATH Magnesium transporter MRS2-10	54.800%	Swiss-Prot	High
`A2YFN7`	Oryza sativa subsp. indica	sp\|A2YFN7\|MRS2B_ORYSI Magnesium transporter MRS2-B	58.400%	Swiss-Prot	High
`Q67UQ7`	Oryza sativa subsp. japonica	sp\|Q67UQ7\|MRS2B_ORYSJ Magnesium transporter MRS2-B	58.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card