TkA05G355470 | RubberDandelionOmics

Gene overview

TkA05G355470

Reference: TK1151 Chr: Chr05 Coordinates: 88093421-88104256 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3276 bp · TkA05G355470|TK1151|cDNA

GCAAAAGAAAAATCAGTGTGTGTGAGGATTGAGGAAAAAGCAGAGAATAAAAAGGAGACCGGATGTTGACAAATTTCATGTCACTGTTCTTAGAAGGTCGTTTGTTTGTGTGAAGATTTCTTATCTGGGATCTCTCTCTTTCTTTCTCTCTCTACAAAAACCTCTTCTTTCTCTCTCTAAAAACCTTCTTTTCTTTCAGACTTCAGAGAGAGAGATAGAGAGAGAGACTGGCCCAGCAGATCGAAAATCCTCATCTTTTT...

CDS

Download CDS FASTA

2487 bp · TkA05G355470|TK1151|CDS

ATGGGAACAGAAGTAGACTGCAAAAGCTCTTTTGAAGGGTATTATTCCATGAGGGATGTTAATGAGGATTCCAATAGTAGCAGCTGGCCTCTCTTTTATGGAGAAAAGCCTTTAAGTAATTCCCATTATTACAATGGCTTCATTCCAAGGCCCATTTCAGATGACAAGGATGCATTAAAGCAAAAAATGCTTGAACATGAAGCCATCTTCAAGAATCAGGTTCACGAACTCCATCGGCTTTATATAAGACAAAGAGACAT...

Protein

Download Protein FASTA

828 aa · TkA05G355470|TK1151|PROTEIN

MGTEVDCKSSFEGYYSMRDVNEDSNSSSWPLFYGEKPLSNSHYYNGFIPRPISDDKDALKQKMLEHEAIFKNQVHELHRLYIRQRDMMEEVKRKELNKHHNSIDASSSSSFLPSQKPYEDNHNHKWQMPTFPCSRPSIFGAEISNSPLSCSKGNNNNNNINNNDHSSKDCEIVECRPSKVRKKLFDLELPPDENMENEEYEGMQCKQVSEESSFRGSNGLADLNEPVHVDEPVVHGFGPSAKPHVGQFFDQRHEFSGRPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G355470`
TK1151 ID	TkA05G355470
OH-1004 ID	LXL04_025137
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	42.700
Protein coverage (%)	TK1151 95.048 / OH-1004 93.952 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G355470`
Location	Chr05:88093421-88104256 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025137` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · TkA05G355470 · TK1151

Cytoplasm0.077

Rank 2 · TkA05G355470 · TK1151

Cell membrane0.024

Rank 3 · TkA05G355470 · TK1151

Endoplasmic reticulum0.013

Rank 4 · TkA05G355470 · TK1151

Plastid0.011

Rank 5 · TkA05G355470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27565ELF3_helical57-86 aa

PF05904DUF863133-214 aa

PF22038PRC2_EED_ins146-165 aa

PF05904DUF863203-300 aa

PF05904DUF863311-478 aa

PF22038PRC2_EED_ins383-404 aa

PF05904DUF863493-817 aa

PF22812CR_prot_dom_plant772-794 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G355470	`PF27565`	ELF3_helical	57	86	6.2e-13	49.0
TkA05G355470	`PF05904`	DUF863	133	214	4.5e-127	426.5
TkA05G355470	`PF22038`	PRC2_EED_ins	146	165	0.32	11.7
TkA05G355470	`PF05904`	DUF863	203	300	4.5e-127	426.5
TkA05G355470	`PF05904`	DUF863	311	478	4.5e-127	426.5
TkA05G355470	`PF22038`	PRC2_EED_ins	383	404	0.32	11.7
TkA05G355470	`PF05904`	DUF863	493	817	4.5e-127	426.5
TkA05G355470	`PF22812`	CR_prot_dom_plant	772	794	0.0082	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card