TkA05G350270 | RubberDandelionOmics

Gene overview

TkA05G350270

Reference: TK1151 Chr: Chr05 Coordinates: 86749447-86754984 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3366 bp · TkA05G350270|TK1151|cDNA

CAAAAATGTAAGAAATGAAAATACTGGACTGATACTGTTATAATAGGAGAACGTTGGGACCAAACACGTAACTTACGGTTATGTTGCCAGGGCGACGAGCCGACGACAGTATGCGACGTTGGGAGGCTAGTCAACACTCATAAACTGACATCTCGCACCCTCGGTGCATACAAAACCACAGTTTGAATAGCAAAATGGCGGCAAAATCACAGTGATGACCTATATTCTTCCATCTACCATTTGAAAGTAGGCCCTTGGAA...

CDS

Download CDS FASTA

2589 bp · TkA05G350270|TK1151|CDS

ATGACAGCAGACGCCTTATTATCGGTTTGTAATTTGGGAGTTTTAGACTCACTCTCCGAAGCTTCAGTCTCTGAGATTTTGGAAAGCTGGACCAGCTTCTGTATGATAACAGAGACGATCGTTAAAGGCGGTGATACTGACTTATCGTCATATTATTCGAAGTTCCAATCCGATGTTTCTAGTCTATGTAAGTTTGGGCTTCGAGATTTAATCGAAGAACATTTCCTTCTGTTTCTCCAGGAAACGTTAGAGAAACATAG...

Protein

Download Protein FASTA

862 aa · TkA05G350270|TK1151|PROTEIN

MTADALLSVCNLGVLDSLSEASVSEILESWTSFCMITETIVKGGDTDLSSYYSKFQSDVSSLCKFGLRDLIEEHFLLFLQETLEKHSAPKFWKNFDAYSNGTDIETNGKDMQEDEVELLLCKALEEISLEKQYQEKCLSMLVNSLQICQDYPSDVENVLFSKYRLIVSSVLMTTLTRHFPEVLHWYFKGRLEELSTIMAGDYEENNELQDKNDQYRKMDIDGSYDQKKVLENKLVRNIGMVVHNLRNLGFTSMTEDAYAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G350270`
TK1151 ID	TkA05G350270
OH-1004 ID	LXL04_021069
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G350270

Location Chr05:86749447-86754984 (-)

Description Similar to APC2: Anaphase-promoting complex subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04660`	Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin-protein ligase complex that controls progression through mitosis and the G1 phase of the cell cycle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021069 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0007091 metaphase/anaphase transition of mitotic cell cycle Biological Process

GO:0007346 regulation of mitotic cell cycle Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031145 anaphase-promoting complex-dependent catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0051301 cell division Biological Process

GO:0051445 regulation of meiotic cell cycle Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

KEGG gene cross-reference

ath:AT2G04660

ddi:DDB_G0276377

hsa:29882

mmu:99152

spo:3361204

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.526

Rank 1 · TkA05G350270 · TK1151

Nucleus0.469

Rank 2 · TkA05G350270 · TK1151

Golgi apparatus0.088

Rank 3 · TkA05G350270 · TK1151

Lysosome / Vacuole0.085

Rank 4 · TkA05G350270 · TK1151

Cell membrane0.047

Rank 5 · TkA05G350270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24874Piezo_THU9_anchor132-171 aa

PF25773TPR_ANAPC2342-450 aa

PF26557Cullin_AB392-410 aa

PF00888Cullin534-606 aa

PF25773TPR_ANAPC2544-566 aa

PF26557Cullin_AB635-740 aa

PF28240Npun_F0494661-724 aa

PF24874Piezo_THU9_anchor793-818 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G350270	`PF24874`	Piezo_THU9_anchor	132	171	0.29	11.2
TkA05G350270	`PF25773`	TPR_ANAPC2	342	450	6.4e-42	142.8
TkA05G350270	`PF26557`	Cullin_AB	392	410	7.5e-16	59.1
TkA05G350270	`PF00888`	Cullin	534	606	0.00067	19.8
TkA05G350270	`PF25773`	TPR_ANAPC2	544	566	6.4e-42	142.8
TkA05G350270	`PF26557`	Cullin_AB	635	740	7.5e-16	59.1
TkA05G350270	`PF28240`	Npun_F0494	661	724	0.096	13.1
TkA05G350270	`PF24874`	Piezo_THU9_anchor	793	818	0.29	11.2
TkA05G350270	`PF08672`	ANAPC2	801	858	3.1e-23	82.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1U5`	Arabidopsis thaliana	sp\|Q8H1U5\|APC2_ARATH Anaphase-promoting complex subunit 2	65.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card