TkA05G342710 | RubberDandelionOmics

Gene overview

TkA05G342710

Reference: TK1151 Chr: Chr05 Coordinates: 84892135-84894108 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1306 bp · TkA05G342710|TK1151|cDNA

CCGGATTACAAACCGTTGCCACAACTCTATGTGGTCTCAAGAAAAAACCGGGTTCGTAATCACCAGTTAATCACACACTGTGTCCTTGAATATCTGTGCCGAAGCTTCGACCAATCTATTCCACTCTCTCGCAAGATCTCACCATATCGCTGAAAGATAAGAGGTATTTTACCCTTGGATCGAGTTGATTCGTATCTATTTGGTGTAAACTTTTGATTAGTATGATAATTTGTTAATCTATCAGCTCGTTCATGTTTATT...

CDS

Download CDS FASTA

729 bp · TkA05G342710|TK1151|CDS

ATGACTCTAGAACATATCGTTGAAGTTACTGGCCTGTCCCCTAGGGCAACAGACCAAGATGTCTACAACTTCTTTGCTTTTTGTGGCACAATCGAGCATGTTGACATTGTCAGGGCGGGTGAATACGCGTGTTCAGCTTACGTAACGTTTAAAGACGCTTACGCCCTTGAAACCGCCGTCTTACTAAGTGGAGCCACACTTTTGGATCAAACCGTTTGCATAACGCGATGGGGACAAGATGCGGACGAATCTCATTTTTG...

Protein

Download Protein FASTA

242 aa · TkA05G342710|TK1151|PROTEIN

MTLEHIVEVTGLSPRATDQDVYNFFAFCGTIEHVDIVRAGEYACSAYVTFKDAYALETAVLLSGATLLDQTVCITRWGQDADESHFWNQPSFSPDDGSGSNIHTDQYAYTAGEAVTLAQDVVKTMISKGYILGKDALVKAKQFDDSHQVSASAAAKVAELSERIGLTDKVFAGVEAVRSVNQRYHISDTTISVVSATGRTAAAAATTVVNSSYFSKGALWMSGALSRAAQAAADLGTHGVGK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G342710`
TK1151 ID	TkA05G342710
OH-1004 ID	LXL04_011081
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	38.100
Protein coverage (%)	TK1151 90.083 / OH-1004 50.125 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G342710

Location Chr05:84892135-84894108 (-)

Description Similar to BPA1: Binding partner of ACD11 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16840`	Binding partner of ACD11 1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011081 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0034051 negative regulation of plant-type hypersensitive response Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G16840

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.466

Rank 1 · TkA05G342710 · TK1151

Mitochondrion0.306

Rank 2 · TkA05G342710 · TK1151

Nucleus0.175

Rank 3 · TkA05G342710 · TK1151

Peroxisome0.112

Rank 4 · TkA05G342710 · TK1151

Cell membrane0.106

Rank 5 · TkA05G342710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23085RRM_PARP14_36-58 aa

PF00076RRM_19-71 aa

PF14605Nup35_RRM_29-60 aa

PF17965MucBP_295-148 aa

PF23085RRM_PARP14_3174-194 aa

PF17965MucBP_2189-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G342710	`PF23085`	RRM_PARP14_3	6	58	0.17	12.7
TkA05G342710	`PF00076`	RRM_1	9	71	2.6e-08	34.3
TkA05G342710	`PF14605`	Nup35_RRM_2	9	60	0.011	16.3
TkA05G342710	`PF17965`	MucBP_2	95	148	0.34	12.0
TkA05G342710	`PF23085`	RRM_PARP14_3	174	194	0.17	12.7
TkA05G342710	`PF17965`	MucBP_2	189	203	0.34	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LFD5`	Arabidopsis thaliana	sp\|Q9LFD5\|BPA1_ARATH Binding partner of ACD11 1	36.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card