TkA05G341710 | RubberDandelionOmics

Gene overview

TkA05G341710

Reference: TK1151 Chr: Chr05 Coordinates: 84651440-84653563 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

786 bp · TkA05G341710|TK1151|cDNA

CCTCATAAGCTCGATCATTATTGCTACAAAGTCTTGAAAGCGGCCACCGGGAAGTTTTCCAACAAAAATTTAGCTGGCCAAGGAGGTTGTGGTGATGTTTATAAAGGCTGGATAGATTCTCGCACTAAAGATTCTACAAAACCAGGACATGGTCTAACCGTTGCCGTTAAAAGAATCAAGAAAGAAGGTGTTCAGGGCATGGACGAATGGAGGAATGAATTGAAAATTTTGAGCAGTTTTAAACATCCGAATGTGGTGAA...

CDS

Download CDS FASTA

786 bp · TkA05G341710|TK1151|CDS

CCTCATAAGCTCGATCATTATTGCTACAAAGTCTTGAAAGCGGCCACCGGGAAGTTTTCCAACAAAAATTTAGCTGGCCAAGGAGGTTGTGGTGATGTTTATAAAGGCTGGATAGATTCTCGCACTAAAGATTCTACAAAACCAGGACATGGTCTAACCGTTGCCGTTAAAAGAATCAAGAAAGAAGGTGTTCAGGGCATGGACGAATGGAGGAATGAATTGAAAATTTTGAGCAGTTTTAAACATCCGAATGTGGTGAA...

Protein

Download Protein FASTA

261 aa · TkA05G341710|TK1151|PROTEIN

PHKLDHYCYKVLKAATGKFSNKNLAGQGGCGDVYKGWIDSRTKDSTKPGHGLTVAVKRIKKEGVQGMDEWRNELKILSSFKHPNVVKLLGYCADGMHRMLVFEFVPNGSLEENLSRECSTELNWRKRIKIAKGLAEGLEYLHTMDIPVIHRDIKSANILLDKDFNAKIADFGLSRFGPQGDKSHVSTVVLGSKGYFAPEYIGTEANEFATIIQQCLSRDPRERPTMTQVLHSLDRLERNMDSWNLSFCNENVITKQSHHM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G341710`
TK1151 ID	TkA05G341710
OH-1004 ID	LXL04_021013
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	77.700
Protein coverage (%)	TK1151 100.000 / OH-1004 90.833 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G341710

Location Chr05:84651440-84653563 (+)

Description Similar to PBL3: Probable serine/threonine-protein kinase PBL3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02800`	May be involved in plant defense signaling.	No verified direct reference in this release
`At1g14370`	Involved in disease resistance signaling.	Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector.2010 · DOI: 10.1016/j.chom.2010.03.007 xopAC-triggered immunity against Xanthomonas depends on Arabidopsis receptor-like cytoplasmic kinase genes PBL2 and RIPK.2013 · DOI: 10.1371/journal.pone.0073469 The Decoy Substrate of a Pathogen Effector and a Pseudokinase Specify Pathogen-Induced Modified-Self Recognition and Immunity in Plants.2015 · DOI: 10.1016/j.chom.2015.08.004 Ligand-triggered allosteric ADP release primes a plant NLR complex.2019 · DOI: 10.1126/science.aav5868
`At2g28930`	Possible bi-functional kinase.	Light-induced stomatal opening is affected by the guard cell protein kinase APK1b.2014 · DOI: 10.1371/journal.pone.0097161
`At1g69790`	May be involved in plant defense signaling.	No verified direct reference in this release
`At1g26970`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021013 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0062207 regulation of pattern recognition receptor signaling pathway Biological Process

GO:1900426 positive regulation of defense response to bacterium Biological Process

GO:1902458 positive regulation of stomatal opening Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004713 protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G07570

ath:AT1G14370

ath:AT2G02800

ath:AT2G28930

ath:AT5G02290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.511

Rank 1 · TkA05G341710 · TK1151

Cytoplasm0.408

Rank 2 · TkA05G341710 · TK1151

Nucleus0.258

Rank 3 · TkA05G341710 · TK1151

Golgi apparatus0.046

Rank 4 · TkA05G341710 · TK1151

Endoplasmic reticulum0.045

Rank 5 · TkA05G341710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase21-204 aa

PF07714PK_Tyr_Ser-Thr25-202 aa

PF01636APH55-112 aa

PF03109ABC167-187 aa

PF12260PIP49_C73-170 aa

PF01636APH148-178 aa

PF12260PIP49_C187-249 aa

PF00069Pkinase206-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G341710	`PF00069`	Pkinase	21	204	1.2e-41	143.6
TkA05G341710	`PF07714`	PK_Tyr_Ser-Thr	25	202	8e-40	137.5
TkA05G341710	`PF01636`	APH	55	112	0.012	16.1
TkA05G341710	`PF03109`	ABC1	67	187	0.0043	17.0
TkA05G341710	`PF12260`	PIP49_C	73	170	0.00036	20.9
TkA05G341710	`PF01636`	APH	148	178	0.012	16.1
TkA05G341710	`PF12260`	PIP49_C	187	249	0.00036	20.9
TkA05G341710	`PF00069`	Pkinase	206	231	1.2e-41	143.6
TkA05G341710	`PF07714`	PK_Tyr_Ser-Thr	206	233	8e-40	137.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49840`	Arabidopsis thaliana	sp\|O49840\|PBL3_ARATH Probable serine/threonine-protein kinase PBL3	48.400%	Swiss-Prot	Medium
`O49839`	Arabidopsis thaliana	sp\|O49839\|PBL2_ARATH Probable serine/threonine-protein kinase PBL2	52.000%	Swiss-Prot	High
`P46573`	Arabidopsis thaliana	sp\|P46573\|PBL10_ARATH Probable serine/threonine-protein kinase PBL10	50.500%	Swiss-Prot	High
`Q5XF79`	Arabidopsis thaliana	sp\|Q5XF79\|PBL18_ARATH Probable serine/threonine-protein kinase PBL18	43.800%	Swiss-Prot	Medium
`Q5PP29`	Arabidopsis thaliana	sp\|Q5PP29\|PBL4_ARATH Probable serine/threonine-protein kinase PBL4	44.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card